ID: 1057470134

View in Genome Browser
Species Human (GRCh38)
Location 9:95349698-95349720
Sequence TTCACAGGGGCTGCGGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057470134_1057470149 23 Left 1057470134 9:95349698-95349720 CCAGCTCCCGCAGCCCCTGTGAA No data
Right 1057470149 9:95349744-95349766 GGTGCGCGCTGTGGCATCTCTGG No data
1057470134_1057470141 2 Left 1057470134 9:95349698-95349720 CCAGCTCCCGCAGCCCCTGTGAA No data
Right 1057470141 9:95349723-95349745 GTCCCCTGTGCCTCCTGCCTAGG No data
1057470134_1057470146 14 Left 1057470134 9:95349698-95349720 CCAGCTCCCGCAGCCCCTGTGAA No data
Right 1057470146 9:95349735-95349757 TCCTGCCTAGGTGCGCGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057470134 Original CRISPR TTCACAGGGGCTGCGGGAGC TGG (reversed) Intergenic
No off target data available for this crispr