ID: 1057470136

View in Genome Browser
Species Human (GRCh38)
Location 9:95349704-95349726
Sequence GGACCTTTCACAGGGGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057470136_1057470141 -4 Left 1057470136 9:95349704-95349726 CCCGCAGCCCCTGTGAAAGGTCC No data
Right 1057470141 9:95349723-95349745 GTCCCCTGTGCCTCCTGCCTAGG No data
1057470136_1057470149 17 Left 1057470136 9:95349704-95349726 CCCGCAGCCCCTGTGAAAGGTCC No data
Right 1057470149 9:95349744-95349766 GGTGCGCGCTGTGGCATCTCTGG No data
1057470136_1057470146 8 Left 1057470136 9:95349704-95349726 CCCGCAGCCCCTGTGAAAGGTCC No data
Right 1057470146 9:95349735-95349757 TCCTGCCTAGGTGCGCGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057470136 Original CRISPR GGACCTTTCACAGGGGCTGC GGG (reversed) Intergenic
No off target data available for this crispr