ID: 1057470139

View in Genome Browser
Species Human (GRCh38)
Location 9:95349712-95349734
Sequence GGCACAGGGGACCTTTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057470139_1057470146 0 Left 1057470139 9:95349712-95349734 CCCTGTGAAAGGTCCCCTGTGCC No data
Right 1057470146 9:95349735-95349757 TCCTGCCTAGGTGCGCGCTGTGG No data
1057470139_1057470151 28 Left 1057470139 9:95349712-95349734 CCCTGTGAAAGGTCCCCTGTGCC No data
Right 1057470151 9:95349763-95349785 CTGGCCAGAAGCACCTTTGGCGG No data
1057470139_1057470150 25 Left 1057470139 9:95349712-95349734 CCCTGTGAAAGGTCCCCTGTGCC No data
Right 1057470150 9:95349760-95349782 TCTCTGGCCAGAAGCACCTTTGG No data
1057470139_1057470149 9 Left 1057470139 9:95349712-95349734 CCCTGTGAAAGGTCCCCTGTGCC No data
Right 1057470149 9:95349744-95349766 GGTGCGCGCTGTGGCATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057470139 Original CRISPR GGCACAGGGGACCTTTCACA GGG (reversed) Intergenic
No off target data available for this crispr