ID: 1057470140

View in Genome Browser
Species Human (GRCh38)
Location 9:95349713-95349735
Sequence AGGCACAGGGGACCTTTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057470140_1057470150 24 Left 1057470140 9:95349713-95349735 CCTGTGAAAGGTCCCCTGTGCCT No data
Right 1057470150 9:95349760-95349782 TCTCTGGCCAGAAGCACCTTTGG No data
1057470140_1057470151 27 Left 1057470140 9:95349713-95349735 CCTGTGAAAGGTCCCCTGTGCCT No data
Right 1057470151 9:95349763-95349785 CTGGCCAGAAGCACCTTTGGCGG No data
1057470140_1057470149 8 Left 1057470140 9:95349713-95349735 CCTGTGAAAGGTCCCCTGTGCCT No data
Right 1057470149 9:95349744-95349766 GGTGCGCGCTGTGGCATCTCTGG No data
1057470140_1057470146 -1 Left 1057470140 9:95349713-95349735 CCTGTGAAAGGTCCCCTGTGCCT No data
Right 1057470146 9:95349735-95349757 TCCTGCCTAGGTGCGCGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057470140 Original CRISPR AGGCACAGGGGACCTTTCAC AGG (reversed) Intergenic