ID: 1057470141

View in Genome Browser
Species Human (GRCh38)
Location 9:95349723-95349745
Sequence GTCCCCTGTGCCTCCTGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057470133_1057470141 19 Left 1057470133 9:95349681-95349703 CCTAGGGCGGGGAAGCGCCAGCT No data
Right 1057470141 9:95349723-95349745 GTCCCCTGTGCCTCCTGCCTAGG No data
1057470132_1057470141 23 Left 1057470132 9:95349677-95349699 CCGGCCTAGGGCGGGGAAGCGCC No data
Right 1057470141 9:95349723-95349745 GTCCCCTGTGCCTCCTGCCTAGG No data
1057470134_1057470141 2 Left 1057470134 9:95349698-95349720 CCAGCTCCCGCAGCCCCTGTGAA No data
Right 1057470141 9:95349723-95349745 GTCCCCTGTGCCTCCTGCCTAGG No data
1057470131_1057470141 24 Left 1057470131 9:95349676-95349698 CCCGGCCTAGGGCGGGGAAGCGC No data
Right 1057470141 9:95349723-95349745 GTCCCCTGTGCCTCCTGCCTAGG No data
1057470136_1057470141 -4 Left 1057470136 9:95349704-95349726 CCCGCAGCCCCTGTGAAAGGTCC No data
Right 1057470141 9:95349723-95349745 GTCCCCTGTGCCTCCTGCCTAGG No data
1057470137_1057470141 -5 Left 1057470137 9:95349705-95349727 CCGCAGCCCCTGTGAAAGGTCCC No data
Right 1057470141 9:95349723-95349745 GTCCCCTGTGCCTCCTGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057470141 Original CRISPR GTCCCCTGTGCCTCCTGCCT AGG Intergenic
No off target data available for this crispr