ID: 1057470144

View in Genome Browser
Species Human (GRCh38)
Location 9:95349727-95349749
Sequence CGCACCTAGGCAGGAGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057470144_1057470149 -6 Left 1057470144 9:95349727-95349749 CCTGTGCCTCCTGCCTAGGTGCG No data
Right 1057470149 9:95349744-95349766 GGTGCGCGCTGTGGCATCTCTGG No data
1057470144_1057470150 10 Left 1057470144 9:95349727-95349749 CCTGTGCCTCCTGCCTAGGTGCG No data
Right 1057470150 9:95349760-95349782 TCTCTGGCCAGAAGCACCTTTGG No data
1057470144_1057470154 22 Left 1057470144 9:95349727-95349749 CCTGTGCCTCCTGCCTAGGTGCG No data
Right 1057470154 9:95349772-95349794 AGCACCTTTGGCGGCCTGTTGGG No data
1057470144_1057470151 13 Left 1057470144 9:95349727-95349749 CCTGTGCCTCCTGCCTAGGTGCG No data
Right 1057470151 9:95349763-95349785 CTGGCCAGAAGCACCTTTGGCGG No data
1057470144_1057470153 21 Left 1057470144 9:95349727-95349749 CCTGTGCCTCCTGCCTAGGTGCG No data
Right 1057470153 9:95349771-95349793 AAGCACCTTTGGCGGCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057470144 Original CRISPR CGCACCTAGGCAGGAGGCAC AGG (reversed) Intergenic
No off target data available for this crispr