ID: 1057470148

View in Genome Browser
Species Human (GRCh38)
Location 9:95349740-95349762
Sequence AGATGCCACAGCGCGCACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057470148_1057470157 26 Left 1057470148 9:95349740-95349762 CCTAGGTGCGCGCTGTGGCATCT No data
Right 1057470157 9:95349789-95349811 GTTGGGCCCCTCGCAGCCTCTGG No data
1057470148_1057470151 0 Left 1057470148 9:95349740-95349762 CCTAGGTGCGCGCTGTGGCATCT No data
Right 1057470151 9:95349763-95349785 CTGGCCAGAAGCACCTTTGGCGG No data
1057470148_1057470154 9 Left 1057470148 9:95349740-95349762 CCTAGGTGCGCGCTGTGGCATCT No data
Right 1057470154 9:95349772-95349794 AGCACCTTTGGCGGCCTGTTGGG No data
1057470148_1057470153 8 Left 1057470148 9:95349740-95349762 CCTAGGTGCGCGCTGTGGCATCT No data
Right 1057470153 9:95349771-95349793 AAGCACCTTTGGCGGCCTGTTGG No data
1057470148_1057470150 -3 Left 1057470148 9:95349740-95349762 CCTAGGTGCGCGCTGTGGCATCT No data
Right 1057470150 9:95349760-95349782 TCTCTGGCCAGAAGCACCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057470148 Original CRISPR AGATGCCACAGCGCGCACCT AGG (reversed) Intergenic
No off target data available for this crispr