ID: 1057470149

View in Genome Browser
Species Human (GRCh38)
Location 9:95349744-95349766
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057470134_1057470149 23 Left 1057470134 9:95349698-95349720 CCAGCTCCCGCAGCCCCTGTGAA No data
Right 1057470149 9:95349744-95349766 GGTGCGCGCTGTGGCATCTCTGG No data
1057470138_1057470149 10 Left 1057470138 9:95349711-95349733 CCCCTGTGAAAGGTCCCCTGTGC No data
Right 1057470149 9:95349744-95349766 GGTGCGCGCTGTGGCATCTCTGG No data
1057470142_1057470149 -4 Left 1057470142 9:95349725-95349747 CCCCTGTGCCTCCTGCCTAGGTG No data
Right 1057470149 9:95349744-95349766 GGTGCGCGCTGTGGCATCTCTGG No data
1057470136_1057470149 17 Left 1057470136 9:95349704-95349726 CCCGCAGCCCCTGTGAAAGGTCC No data
Right 1057470149 9:95349744-95349766 GGTGCGCGCTGTGGCATCTCTGG No data
1057470139_1057470149 9 Left 1057470139 9:95349712-95349734 CCCTGTGAAAGGTCCCCTGTGCC No data
Right 1057470149 9:95349744-95349766 GGTGCGCGCTGTGGCATCTCTGG No data
1057470140_1057470149 8 Left 1057470140 9:95349713-95349735 CCTGTGAAAGGTCCCCTGTGCCT No data
Right 1057470149 9:95349744-95349766 GGTGCGCGCTGTGGCATCTCTGG No data
1057470144_1057470149 -6 Left 1057470144 9:95349727-95349749 CCTGTGCCTCCTGCCTAGGTGCG No data
Right 1057470149 9:95349744-95349766 GGTGCGCGCTGTGGCATCTCTGG No data
1057470143_1057470149 -5 Left 1057470143 9:95349726-95349748 CCCTGTGCCTCCTGCCTAGGTGC No data
Right 1057470149 9:95349744-95349766 GGTGCGCGCTGTGGCATCTCTGG No data
1057470137_1057470149 16 Left 1057470137 9:95349705-95349727 CCGCAGCCCCTGTGAAAGGTCCC No data
Right 1057470149 9:95349744-95349766 GGTGCGCGCTGTGGCATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057470149 Original CRISPR GGTGCGCGCTGTGGCATCTC TGG Intergenic