ID: 1057470151

View in Genome Browser
Species Human (GRCh38)
Location 9:95349763-95349785
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057470140_1057470151 27 Left 1057470140 9:95349713-95349735 CCTGTGAAAGGTCCCCTGTGCCT No data
Right 1057470151 9:95349763-95349785 CTGGCCAGAAGCACCTTTGGCGG No data
1057470148_1057470151 0 Left 1057470148 9:95349740-95349762 CCTAGGTGCGCGCTGTGGCATCT No data
Right 1057470151 9:95349763-95349785 CTGGCCAGAAGCACCTTTGGCGG No data
1057470139_1057470151 28 Left 1057470139 9:95349712-95349734 CCCTGTGAAAGGTCCCCTGTGCC No data
Right 1057470151 9:95349763-95349785 CTGGCCAGAAGCACCTTTGGCGG No data
1057470147_1057470151 4 Left 1057470147 9:95349736-95349758 CCTGCCTAGGTGCGCGCTGTGGC No data
Right 1057470151 9:95349763-95349785 CTGGCCAGAAGCACCTTTGGCGG No data
1057470142_1057470151 15 Left 1057470142 9:95349725-95349747 CCCCTGTGCCTCCTGCCTAGGTG No data
Right 1057470151 9:95349763-95349785 CTGGCCAGAAGCACCTTTGGCGG No data
1057470144_1057470151 13 Left 1057470144 9:95349727-95349749 CCTGTGCCTCCTGCCTAGGTGCG No data
Right 1057470151 9:95349763-95349785 CTGGCCAGAAGCACCTTTGGCGG No data
1057470138_1057470151 29 Left 1057470138 9:95349711-95349733 CCCCTGTGAAAGGTCCCCTGTGC No data
Right 1057470151 9:95349763-95349785 CTGGCCAGAAGCACCTTTGGCGG No data
1057470145_1057470151 7 Left 1057470145 9:95349733-95349755 CCTCCTGCCTAGGTGCGCGCTGT No data
Right 1057470151 9:95349763-95349785 CTGGCCAGAAGCACCTTTGGCGG No data
1057470143_1057470151 14 Left 1057470143 9:95349726-95349748 CCCTGTGCCTCCTGCCTAGGTGC No data
Right 1057470151 9:95349763-95349785 CTGGCCAGAAGCACCTTTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057470151 Original CRISPR CTGGCCAGAAGCACCTTTGG CGG Intergenic