ID: 1057470154

View in Genome Browser
Species Human (GRCh38)
Location 9:95349772-95349794
Sequence AGCACCTTTGGCGGCCTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057470147_1057470154 13 Left 1057470147 9:95349736-95349758 CCTGCCTAGGTGCGCGCTGTGGC No data
Right 1057470154 9:95349772-95349794 AGCACCTTTGGCGGCCTGTTGGG No data
1057470148_1057470154 9 Left 1057470148 9:95349740-95349762 CCTAGGTGCGCGCTGTGGCATCT No data
Right 1057470154 9:95349772-95349794 AGCACCTTTGGCGGCCTGTTGGG No data
1057470142_1057470154 24 Left 1057470142 9:95349725-95349747 CCCCTGTGCCTCCTGCCTAGGTG No data
Right 1057470154 9:95349772-95349794 AGCACCTTTGGCGGCCTGTTGGG No data
1057470145_1057470154 16 Left 1057470145 9:95349733-95349755 CCTCCTGCCTAGGTGCGCGCTGT No data
Right 1057470154 9:95349772-95349794 AGCACCTTTGGCGGCCTGTTGGG No data
1057470143_1057470154 23 Left 1057470143 9:95349726-95349748 CCCTGTGCCTCCTGCCTAGGTGC No data
Right 1057470154 9:95349772-95349794 AGCACCTTTGGCGGCCTGTTGGG No data
1057470144_1057470154 22 Left 1057470144 9:95349727-95349749 CCTGTGCCTCCTGCCTAGGTGCG No data
Right 1057470154 9:95349772-95349794 AGCACCTTTGGCGGCCTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057470154 Original CRISPR AGCACCTTTGGCGGCCTGTT GGG Intergenic
No off target data available for this crispr