ID: 1057474075

View in Genome Browser
Species Human (GRCh38)
Location 9:95384164-95384186
Sequence GCATCTCCCAAGTATAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057474075_1057474080 4 Left 1057474075 9:95384164-95384186 CCTTTTCTATACTTGGGAGATGC No data
Right 1057474080 9:95384191-95384213 CCTGATCCTGGCTCCCATCTTGG No data
1057474075_1057474081 7 Left 1057474075 9:95384164-95384186 CCTTTTCTATACTTGGGAGATGC No data
Right 1057474081 9:95384194-95384216 GATCCTGGCTCCCATCTTGGAGG No data
1057474075_1057474076 -8 Left 1057474075 9:95384164-95384186 CCTTTTCTATACTTGGGAGATGC No data
Right 1057474076 9:95384179-95384201 GGAGATGCCCTGCCTGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057474075 Original CRISPR GCATCTCCCAAGTATAGAAA AGG (reversed) Intergenic
No off target data available for this crispr