ID: 1057475235

View in Genome Browser
Species Human (GRCh38)
Location 9:95394343-95394365
Sequence CTCATTATGTCTTGTCTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057475235_1057475239 10 Left 1057475235 9:95394343-95394365 CCAAAGAGACAAGACATAATGAG No data
Right 1057475239 9:95394376-95394398 GAAGCTGCAATGTGTATGGCAGG No data
1057475235_1057475238 6 Left 1057475235 9:95394343-95394365 CCAAAGAGACAAGACATAATGAG No data
Right 1057475238 9:95394372-95394394 TTAGGAAGCTGCAATGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057475235 Original CRISPR CTCATTATGTCTTGTCTCTT TGG (reversed) Intergenic
No off target data available for this crispr