ID: 1057477534

View in Genome Browser
Species Human (GRCh38)
Location 9:95415563-95415585
Sequence TCTGGCCAGGAATGCTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057477534_1057477544 30 Left 1057477534 9:95415563-95415585 CCCCAGCAGCATTCCTGGCCAGA 0: 1
1: 0
2: 2
3: 18
4: 248
Right 1057477544 9:95415616-95415638 AGATTGTGCCTCCACATCTTTGG 0: 1
1: 0
2: 0
3: 8
4: 142
1057477534_1057477539 4 Left 1057477534 9:95415563-95415585 CCCCAGCAGCATTCCTGGCCAGA 0: 1
1: 0
2: 2
3: 18
4: 248
Right 1057477539 9:95415590-95415612 GCACCCCTAGCTTCTCTACCAGG 0: 1
1: 0
2: 0
3: 10
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057477534 Original CRISPR TCTGGCCAGGAATGCTGCTG GGG (reversed) Intergenic
900029460 1:360322-360344 GCTAGCAAGGAATGCTGCTAAGG + Intergenic
900050062 1:589095-589117 GCTAGCAAGGAATGCTGCTAAGG + Intergenic
900691295 1:3982126-3982148 TCTGGCCAGGGTGCCTGCTGGGG + Intergenic
902285468 1:15405661-15405683 TCAGGCCAGGTATCCTGATGTGG + Intergenic
902546936 1:17195980-17196002 TCTGTCCAGGAGGGCTGCTGGGG + Intergenic
903499940 1:23795235-23795257 CCTGGGCAGGAGTGCTGGTGAGG + Exonic
905305645 1:37015971-37015993 GCTGGGCAGGAAATCTGCTGTGG - Intronic
906556515 1:46718694-46718716 CCTGGCCAGGAAGCCGGCTGGGG + Exonic
907537714 1:55180128-55180150 TGGGGCCAGAAATACTGCTGTGG - Intronic
912156280 1:106924542-106924564 GCTGACCAGGAATACTGCTCTGG - Intergenic
912249942 1:108000757-108000779 TCTGGCCTGGAGTGCTCCAGGGG - Intergenic
912564710 1:110579403-110579425 TTTGTCCAGGAAAGCAGCTGTGG + Intergenic
912722623 1:112032868-112032890 TCTGCTCAGGGCTGCTGCTGAGG - Intergenic
913088254 1:115458706-115458728 TCTGGACAGGATAGCTTCTGGGG - Intergenic
915040343 1:152963103-152963125 TCTGGCCAGGAAACCTTCTGGGG - Intergenic
917718078 1:177758214-177758236 TCAGGTTAGGAAGGCTGCTGGGG - Intergenic
918133111 1:181646301-181646323 AGAGGCCAGGAATGCTGCTAAGG + Intronic
922725124 1:227919219-227919241 TGTGGCCAGCTATGCTGCTCAGG + Exonic
923329590 1:232910342-232910364 TCTGGCCTGCATTGCTGCAGTGG + Intergenic
924420362 1:243903708-243903730 TCAGTCCTGGAATGTTGCTGAGG - Intergenic
924453458 1:244199309-244199331 TCAGTCCAGGAATCATGCTGGGG - Intergenic
1062815037 10:493144-493166 ACTGGCCAGGATGACTGCTGGGG - Intronic
1063216585 10:3931086-3931108 AAGGGCCAGGCATGCTGCTGGGG - Intergenic
1069589626 10:69633863-69633885 TCTGGCCAGAATGGCTGGTGAGG + Intergenic
1069599204 10:69692635-69692657 TCTGGGCAGGAAGGGTGATGAGG + Intergenic
1069599437 10:69693928-69693950 TCTGGGCAGGAAGGGTGATGAGG - Intergenic
1071732468 10:88262085-88262107 TCTGGGCAGGATTCATGCTGGGG + Intergenic
1073180755 10:101581484-101581506 TGTGGCCTGGAATGGAGCTGGGG + Intronic
1074931532 10:118131578-118131600 TCTGGCAGTGAATCCTGCTGTGG - Intergenic
1076050844 10:127332071-127332093 CTTGGCCAGGAATGCTGTTTTGG + Intronic
1077548693 11:3189388-3189410 TCTGGCCAGGGAGGCGGGTGGGG + Intergenic
1079303132 11:19297292-19297314 TCTGGGCAGGACCACTGCTGGGG - Intergenic
1083322706 11:61857198-61857220 TCTGCACAGCAAGGCTGCTGTGG - Intronic
1083412833 11:62505770-62505792 TGTGGCCAGGGGTCCTGCTGGGG - Intronic
1083694984 11:64436741-64436763 TCTGGGCAGGAATGTTGCGAAGG + Intergenic
1084121951 11:67074649-67074671 TCAGGCCAGAAATGAAGCTGTGG + Intergenic
1085161772 11:74354387-74354409 TCTGCCCGTGGATGCTGCTGAGG + Intronic
1088529149 11:110789011-110789033 TCTGTCCGTGGATGCTGCTGAGG - Intergenic
1088973079 11:114790608-114790630 TCTGGCCCTGACTGCTGCTCAGG - Intergenic
1089213014 11:116819236-116819258 CCAGGCCAGTAAGGCTGCTGCGG - Intergenic
1089496652 11:118911436-118911458 TCTGGGGAGGAAGGCTCCTGGGG + Intronic
1090131632 11:124148274-124148296 TGTGGCCAAGTCTGCTGCTGTGG - Intergenic
1090165327 11:124540598-124540620 TCTGGGAAGGGATGCAGCTGAGG - Intergenic
1090242395 11:125193319-125193341 TCTACCGAGGAATGCTGCAGAGG + Intronic
1090644024 11:128753013-128753035 TCTGGCAAGGCAAGCTGCTTGGG - Intronic
1091207214 11:133830074-133830096 TCTGCCCAGAGATGGTGCTGAGG + Intergenic
1091395739 12:153341-153363 GCCAGCCAGGAGTGCTGCTGCGG + Intronic
1091686623 12:2567092-2567114 ACTGCCCAGCAATGATGCTGAGG - Intronic
1094544994 12:31396318-31396340 GCTGGCCAGGCATTATGCTGAGG - Intronic
1095129476 12:38522173-38522195 TGTGGACAGGAAGGCTGCTAAGG - Intergenic
1096219743 12:49821523-49821545 TCAGGCCAGGACTGCAGATGTGG - Intronic
1096424374 12:51488873-51488895 TCTGACCTAGAAGGCTGCTGTGG + Intronic
1096778374 12:53977690-53977712 TGTGGGCAGGAATGCAACTGAGG + Intergenic
1097170197 12:57108402-57108424 TCTGGCCATGAGTGGTGGTGGGG - Intronic
1097316071 12:58172800-58172822 TCTGGTCATGAATGCTTCTGAGG + Intergenic
1098556660 12:71826014-71826036 TCTGGAGAGGAAGGCTCCTGTGG + Intergenic
1100726659 12:97416318-97416340 TCAGGTCAGGAATCCTCCTGTGG + Intergenic
1102347407 12:112168790-112168812 TCTGGGCAGGTTCGCTGCTGTGG + Intronic
1103028656 12:117594517-117594539 TGAGGCCAGGAAGCCTGCTGAGG + Intronic
1103460494 12:121100622-121100644 TCTAGCCAGGTATGCACCTGTGG - Intergenic
1104190602 12:126479144-126479166 CCTGGCCAGGAAAGAAGCTGGGG - Intergenic
1104307884 12:127626197-127626219 TCTGCCAAGGTATGCAGCTGGGG + Intergenic
1106455726 13:29924900-29924922 TCTGGGAAGGACTCCTGCTGGGG + Intergenic
1109107641 13:58275818-58275840 TCTGTCCCAGGATGCTGCTGTGG - Intergenic
1111643047 13:90995377-90995399 TCTCTCCAGGAATGCTGCCAAGG - Intergenic
1112407540 13:99134581-99134603 TCTGGCCAGCACTGGTGGTGTGG - Intergenic
1113196985 13:107819381-107819403 AGTTGCCAGAAATGCTGCTGAGG - Intronic
1113389170 13:109879500-109879522 ACTGGCCAGGAGTCCTGCTTGGG + Intergenic
1114568915 14:23652196-23652218 TCTGGCCAGGGTTATTGCTGAGG - Intergenic
1117458409 14:55920579-55920601 TCTGGCCTGGAACGCTGCTCTGG - Intergenic
1117617686 14:57550530-57550552 TGTGGTCAGGAATCCTGGTGTGG - Intergenic
1121046003 14:90788189-90788211 TCTGGCATTGGATGCTGCTGTGG - Intronic
1121765627 14:96483132-96483154 GCTGGCCAGGGAGGCTGCTGAGG + Exonic
1122781409 14:104145393-104145415 TGAGGCCTGGGATGCTGCTGGGG - Intronic
1123918628 15:25055245-25055267 CCTGGCCAGGAACTCTGCTGTGG + Intergenic
1124597488 15:31102862-31102884 CCAGGCCAGGGAGGCTGCTGCGG - Intronic
1124625706 15:31306484-31306506 TCTGACCAGGAAAGATGCAGAGG - Intergenic
1124682108 15:31740522-31740544 TCTGGCGAGGACGGCTGCCGTGG + Intronic
1124899473 15:33808949-33808971 GCTGGCCAGGGATTTTGCTGTGG + Intronic
1126274305 15:46858286-46858308 TATGGCCAGCAATTCTCCTGGGG + Intergenic
1127819760 15:62644531-62644553 TCTGTCAAGAAAGGCTGCTGGGG - Exonic
1129192050 15:73942954-73942976 TCTGGCCAGGTAAGGAGCTGAGG + Exonic
1129705595 15:77792316-77792338 TCTGGTCTGGACTGATGCTGGGG + Intronic
1129868345 15:78925535-78925557 TCTGGCCATCCATGCTGCTCTGG - Intronic
1130648775 15:85750553-85750575 CCAGGCCAGGATGGCTGCTGTGG - Intergenic
1131089125 15:89606786-89606808 ACTGGCTGGGAAGGCTGCTGAGG - Exonic
1132131606 15:99285611-99285633 GCTGCCCATGGATGCTGCTGAGG - Intronic
1134040981 16:11067979-11068001 CCTGGCAAGGCAGGCTGCTGTGG + Intronic
1135730877 16:24894243-24894265 TCTGCACAGAAATGCAGCTGGGG - Intronic
1135977149 16:27115998-27116020 TCAGGCCATGCGTGCTGCTGTGG - Intergenic
1136369778 16:29829142-29829164 TCTGGCCAGGACAGGTGCAGTGG - Intronic
1136656808 16:31713935-31713957 TCAGCTTAGGAATGCTGCTGGGG + Intronic
1137584843 16:49658271-49658293 TCTGGCCAGGCACGGTGCTGGGG - Intronic
1138680022 16:58677631-58677653 GATGGCCAGGAATGCTGATCAGG - Intronic
1139494018 16:67303024-67303046 TCTGCCCAGGGAAGCTCCTGAGG + Intronic
1139727991 16:68917559-68917581 TTTCACCAGGAATGCTGGTGAGG - Intronic
1140253898 16:73318542-73318564 TCTGGCTAATAATGCTTCTGAGG + Intergenic
1140632823 16:76874050-76874072 TTGGGCCAGGCCTGCTGCTGAGG + Intergenic
1141632879 16:85298256-85298278 TCTGGGCAGGGAGGCAGCTGAGG - Intergenic
1143183746 17:4998732-4998754 TCTGCCCAGGAAGACTGGTGAGG + Intronic
1143829192 17:9637612-9637634 CCTGGCCAGGCGTGCTGCAGTGG + Intronic
1144207279 17:12988104-12988126 TTTTCCCAGGAATGCTGATGAGG + Intronic
1144223921 17:13126190-13126212 TTTTGGCAGGAATGCTGCAGAGG + Intergenic
1145811435 17:27766565-27766587 TCTTGGCATGCATGCTGCTGAGG + Exonic
1147293527 17:39462244-39462266 TGTGCCCAGGGATGCTGCTTCGG - Exonic
1148026611 17:44593290-44593312 TTAGGCCAGGAAGGCTGCAGCGG - Intergenic
1149989210 17:61371749-61371771 CCTGGCTACGGATGCTGCTGTGG - Intronic
1151334539 17:73432173-73432195 CCTGACCAGGGCTGCTGCTGGGG - Intronic
1151420372 17:73993185-73993207 ACAGGCCAGGGATGCTGCTCTGG + Intergenic
1151801451 17:76382213-76382235 TCTGAGCAGGGATGCAGCTGGGG + Intronic
1152453396 17:80397935-80397957 TCTGGCCAGGCATTCCACTGGGG - Exonic
1152716604 17:81903397-81903419 TCTGGCCTCCAATGCTGCTACGG + Intronic
1152950297 17:83226234-83226256 GCTAGCAAGGAATGCTGCTAAGG - Intergenic
1153391775 18:4569825-4569847 TCAGGCCAGAAATACTGCTGTGG - Intergenic
1154433310 18:14325112-14325134 TCTGGGCAGCAAAGCTGCAGTGG + Intergenic
1156608399 18:38696615-38696637 CCTTACCAGGATTGCTGCTGAGG + Intergenic
1160272015 18:77395533-77395555 TCTGGCCAGGAATATTGTTTAGG - Intergenic
1160629054 18:80232760-80232782 CCTGCCCATGAATGCTGGTGTGG - Intronic
1161060334 19:2211487-2211509 GCAGGCCAGGGATGCTGCTCAGG + Intronic
1162023323 19:7878914-7878936 CCTGGGCAGGAGTGCTGGTGAGG - Intergenic
1162326390 19:10002236-10002258 TCTGGCCTGGACAGCTGCAGAGG + Intronic
1163291070 19:16379263-16379285 GTTGCCCAGGAGTGCTGCTGTGG - Intronic
1165013694 19:32866059-32866081 TCTGGCCGGGGCTGCTTCTGAGG - Intronic
1165282520 19:34809411-34809433 TCTGGCTAGGAATGGTGGCGAGG - Intergenic
1165779098 19:38421933-38421955 TAGGGCCAGGGAGGCTGCTGGGG + Intronic
1165782453 19:38442280-38442302 TGTGGCAGGGAATGTTGCTGGGG + Intronic
1166998980 19:46733968-46733990 CCTGGCCAGGAAGCCTCCTGAGG - Intronic
1167405092 19:49301498-49301520 AGTGGCCAGGAGTGCTGTTGAGG - Intronic
1167575305 19:50314949-50314971 TCAGGCCCGCGATGCTGCTGAGG + Intronic
1167876536 19:52418619-52418641 TCTGCCCTAGAATGCTTCTGTGG + Intergenic
1168723365 19:58567314-58567336 GCTGGGCAGGGCTGCTGCTGTGG + Intronic
926048763 2:9729788-9729810 ACTGGCCAGGGGTGCTGCTGTGG + Intergenic
933245890 2:79974551-79974573 TTTGACTAGGAATGCTGCTAAGG - Intronic
934708843 2:96502565-96502587 CCTGGCCAGGCATGGGGCTGGGG + Intronic
936074124 2:109390892-109390914 TCCCGGCATGAATGCTGCTGTGG + Intronic
936114250 2:109689303-109689325 GCTGCCCAGGCATGCTGTTGTGG - Intergenic
938117290 2:128610639-128610661 TCTGGGCAGGAGTGTTTCTGTGG - Intergenic
940286505 2:152038027-152038049 TCTGGCCAGGAAAACTGGGGAGG + Intronic
942244948 2:173999276-173999298 GCTGCCCAGGAGTGCTGCTGGGG - Intergenic
946182931 2:217959856-217959878 CCTCTCCAGGAATGCGGCTGGGG + Intronic
946669526 2:222087943-222087965 TCAGGACAGAAATGCTGCTCAGG + Intergenic
948374849 2:237514653-237514675 CCTGGCTGGCAATGCTGCTGGGG - Intronic
948387650 2:237591522-237591544 ACTGGCCTGGACTTCTGCTGAGG + Intronic
1169070797 20:2728708-2728730 TCAGGTTAGGAATCCTGCTGTGG - Intronic
1169113773 20:3049477-3049499 TCTGGCCAGAGTTGATGCTGGGG - Intergenic
1172110969 20:32544651-32544673 GCTGGCCAGGATGCCTGCTGAGG - Intronic
1172768110 20:37361762-37361784 GCAGGGCAGGAGTGCTGCTGAGG + Intronic
1173253433 20:41376356-41376378 TCTTCCCAGGAATGCTGCCCTGG - Intergenic
1174215917 20:48916241-48916263 TCTGACCAGGAGTGCTGTTTTGG - Intergenic
1174527898 20:51188445-51188467 TCTGCCCAGGAATCCCTCTGTGG - Intergenic
1175214897 20:57386979-57387001 GCTGTCCACCAATGCTGCTGGGG + Intergenic
1175775619 20:61651650-61651672 TCTGGTCAGCATTGCTGCAGGGG + Intronic
1175967764 20:62668149-62668171 TTAGTGCAGGAATGCTGCTGAGG - Exonic
1176122567 20:63460677-63460699 CCTGGCCAGGAAGGCTGGTGAGG - Intronic
1176983653 21:15411361-15411383 TTTTGCCAGGAATTTTGCTGAGG - Intergenic
1179494874 21:41765307-41765329 TCAGGCCAGGAGGGGTGCTGTGG - Intronic
1179785542 21:43727872-43727894 TTGGGTCAGGAATGCTGCTTTGG + Intronic
1181264419 22:21622464-21622486 TCTCGCCAGAAAGGCTCCTGAGG + Exonic
1181423106 22:22815454-22815476 TCAGGACAGGAAGGCTCCTGGGG - Intronic
1181620925 22:24090699-24090721 TCTGGCAAGGGCAGCTGCTGTGG - Intronic
1181665508 22:24393158-24393180 TGGGGCCAGAAATACTGCTGTGG + Intronic
1181902557 22:26168687-26168709 CCTGGGCAAGAATGCTGCAGAGG + Intergenic
1183474152 22:38026730-38026752 TGTGCCCAGGCAGGCTGCTGGGG + Intronic
1183560549 22:38569755-38569777 TCTGCCCAGGCCTCCTGCTGAGG - Intronic
1183712312 22:39512374-39512396 TCGGGCCAAGCAAGCTGCTGTGG + Exonic
1184652153 22:45924373-45924395 TCAGGCCAGGGAAGCTGCTTGGG - Intronic
1184682006 22:46077334-46077356 ACTGGCCAAGAAAGCTGCTTGGG - Intronic
1184978001 22:48076731-48076753 TGTGGCCAGGAATCCTGCGTGGG - Intergenic
949433789 3:4006387-4006409 TCTAGCTATGAATGCTGATGTGG + Intronic
951592128 3:24277771-24277793 TTTGGCCAGGAAAGCTCTTGAGG - Intronic
951641742 3:24844210-24844232 TCTTGCCAGGAGATCTGCTGAGG + Intergenic
953032009 3:39185542-39185564 TCTGGCCAGCAGGGCTGCTGTGG + Exonic
953732909 3:45465350-45465372 TCTGGCCAGCAATCATGCTGAGG - Intronic
954117990 3:48477886-48477908 TCTGGCCAGGAAGCCGCCTGAGG + Intronic
954544375 3:51420212-51420234 TCTGGGCAGCCATGCTGCTGTGG - Exonic
954972255 3:54661112-54661134 AATGGCCAGGAAGGCTTCTGAGG + Intronic
955558521 3:60163613-60163635 CCTGGCCAGGGATGCTGGAGAGG - Intronic
958471409 3:94525251-94525273 TCTGTCCAGGAATGCCACAGGGG + Intergenic
959110983 3:102123150-102123172 TCTGGGCAGGAAAGCTGATGAGG + Intronic
961068665 3:123899516-123899538 TCTGGCCAGGACTGCTGGATGGG - Intronic
961646120 3:128393705-128393727 ACTGTCCAGCATTGCTGCTGAGG - Intronic
961738109 3:129014983-129015005 GCTGTCCAGGAGTGGTGCTGGGG - Intronic
962265489 3:133941639-133941661 GCTGGCAATGAATGCTTCTGAGG - Intronic
965381266 3:167991964-167991986 TCAGGCCAGTAATTCTGCTCTGG + Intergenic
968502527 4:957549-957571 GCTGGCCCAGAGTGCTGCTGGGG - Intronic
968695000 4:2019981-2020003 GATAGCCAGGAATGCTGGTGTGG - Intronic
968901775 4:3435468-3435490 TCAGGCCTGCAAAGCTGCTGAGG + Intronic
969969253 4:11028814-11028836 CCTGCCCAGGAAAGCTGCTCTGG + Intergenic
977049297 4:92106871-92106893 ACTGTCCAGGAACTCTGCTGGGG + Intergenic
979274775 4:118802798-118802820 TCTTGTGAGTAATGCTGCTGTGG - Intronic
981475563 4:145183367-145183389 TCTGGCCAGGGTTTCTCCTGAGG - Intergenic
981847140 4:149182358-149182380 TTTGATCAGGAGTGCTGCTGTGG + Intergenic
981937145 4:150250397-150250419 TCAGGCCTGGACAGCTGCTGCGG - Intronic
989175791 5:38524429-38524451 TCTAGCCAGGATTGCTCCAGTGG - Intronic
990947388 5:61263238-61263260 TCTCACCTGGAGTGCTGCTGAGG - Intergenic
991454458 5:66787672-66787694 TCTGGAGAGGAATGAGGCTGGGG + Intronic
998879002 5:146628315-146628337 CCTGGACAGGAAGGCTGCTTTGG + Intronic
1001234967 5:170021853-170021875 TCTGGCCATCAAGGCTGCTTGGG - Intronic
1001542862 5:172551358-172551380 GCTGGCCAAGAATGCTGCCCTGG - Intergenic
1002744530 5:181460049-181460071 GCTAGCAAGGAATGCTGCTAAGG - Intergenic
1003265121 6:4559038-4559060 TCGGTCCAGCCATGCTGCTGTGG - Intergenic
1003409576 6:5850831-5850853 GCTGGTCAGGAATGCTCCGGGGG - Intergenic
1004254667 6:14051906-14051928 TTTGGGCAGGAACGCTGCAGGGG - Intergenic
1006327424 6:33365019-33365041 CCTGGGCAGGAGTGCTGGTGAGG - Intergenic
1007345887 6:41229139-41229161 TCCTGCCAGGTATTCTGCTGTGG + Intronic
1010658607 6:78542669-78542691 TCTAGGCAGAAAGGCTGCTGGGG + Intergenic
1012430568 6:99159780-99159802 TTTCAGCAGGAATGCTGCTGAGG - Intergenic
1012693215 6:102344030-102344052 TCTGGCTACTAATGATGCTGAGG - Intergenic
1012932687 6:105333492-105333514 TCTTGCCAGGAATCCTGAAGTGG - Exonic
1015754734 6:136596061-136596083 TCCAGCCAGGTAGGCTGCTGAGG - Intronic
1015918387 6:138241784-138241806 TCTGTCCTGGCATGCAGCTGGGG - Intronic
1016537843 6:145128094-145128116 TCTGGCCAGCCATTCTGCTGAGG - Intergenic
1016822928 6:148363054-148363076 TCTGGGCAGATATGCTGATGTGG + Intronic
1017267111 6:152460186-152460208 TATGGCCCTGAAAGCTGCTGGGG + Intronic
1017796520 6:157849793-157849815 TCTGTGCTGGAATGCTGATGAGG + Intronic
1018611247 6:165649599-165649621 TCTGCCCTGCAAAGCTGCTGAGG + Intronic
1019169449 6:170123983-170124005 GCTGTCCATGAAGGCTGCTGTGG - Intergenic
1019249440 6:170733589-170733611 GCTAGCAAGGAATGCTGCTAAGG - Intergenic
1019279322 7:192297-192319 TCTGGCCAGGCCAGCAGCTGCGG - Intergenic
1022455900 7:30558307-30558329 TCTAGCCAAGAAGGCTGATGAGG - Intergenic
1027363473 7:77433077-77433099 TCTGGCCAGGAGTTCTGAAGTGG + Intergenic
1027455472 7:78386089-78386111 TCTGCCCAGGAATGCTGCAGAGG - Intronic
1028762504 7:94510484-94510506 CCTGGCCAAAAGTGCTGCTGAGG + Intronic
1029926559 7:104325657-104325679 TGTGACCAGGAAAGCTGCTTTGG - Intergenic
1034551696 7:151824767-151824789 TCTGTCCTGGCTTGCTGCTGAGG + Intronic
1035000568 7:155609429-155609451 GCTGGACAGGGCTGCTGCTGGGG - Intergenic
1035498656 8:74060-74082 GCTAGCAAGGAATGCTGCTAAGG + Intronic
1035908414 8:3538828-3538850 TCTCACCTGGAGTGCTGCTGCGG + Intronic
1036562198 8:9906744-9906766 TCTGGGCAGGACAGCTGCGGGGG + Intergenic
1036808373 8:11850690-11850712 TCTGGCCATGAATGATGGCGAGG - Intronic
1036822694 8:11953049-11953071 TCAGGGCAGGAATGAAGCTGAGG + Intergenic
1037323042 8:17661848-17661870 ACTGGCCCGGTGTGCTGCTGGGG + Intronic
1037501145 8:19486531-19486553 TCTGGGCAGGAATGCTTCGAGGG - Intronic
1039765889 8:40627194-40627216 TCAGGCTAAGAATGTTGCTGTGG + Intronic
1046560083 8:115825250-115825272 TCTGAGCAGGCATCCTGCTGTGG + Intergenic
1046801598 8:118434651-118434673 CCTGGCCTGGAATGCTGATGAGG - Intronic
1048280997 8:133105710-133105732 TCTGTCCACGAATGCTTGTGGGG - Intronic
1049567352 8:143348019-143348041 TCTGGCTTGCAAGGCTGCTGTGG - Intronic
1049596230 8:143484751-143484773 GCTGGCCAGGAATCCTGCCTAGG + Intronic
1051863892 9:21656973-21656995 CCTGGGATGGAATGCTGCTGGGG - Intergenic
1052817804 9:33114986-33115008 TCTGCCCAGGAGTGCCTCTGTGG + Intronic
1053644967 9:40114775-40114797 TGTGGCCAGAAGTGCTCCTGGGG + Intergenic
1053760753 9:41348753-41348775 TGTGGCCAGAAGTGCTCCTGGGG - Intergenic
1054325987 9:63712673-63712695 TGTGGCCAGAAGTGCTCCTGGGG + Intergenic
1054539608 9:66261194-66261216 TGTGGCCAGAAGTGCTCCTGGGG - Intergenic
1054888626 9:70227850-70227872 TCTGGACAGGAATAATGCTTTGG - Intergenic
1056172798 9:84004481-84004503 TCTGGCCTGGATTACTGCAGTGG + Intergenic
1057190156 9:93082869-93082891 TCTGGCCAGCAAAGCCCCTGCGG - Intronic
1057477534 9:95415563-95415585 TCTGGCCAGGAATGCTGCTGGGG - Intergenic
1057800293 9:98186895-98186917 CCAGGCCTGGAGTGCTGCTGTGG - Intronic
1057936499 9:99243898-99243920 TCAGCCCTGGAATGCTTCTGTGG - Intergenic
1059540068 9:115121474-115121496 TTTGGCCAGGACTAGTGCTGAGG + Intergenic
1059930801 9:119258643-119258665 TCTTGCCACCAATGGTGCTGTGG - Intronic
1061169171 9:128942061-128942083 TCTGGAAAGCAATGCTGCTTGGG - Intronic
1061318149 9:129810376-129810398 TCTGTCCAGGTCTGCTGCAGAGG - Exonic
1062287808 9:135780871-135780893 TGTGGACAGGGATGCTGCCGTGG + Intronic
1062401064 9:136372845-136372867 GCTGGCCAGGAGTGCTGCTGCGG + Intronic
1203610339 Un_KI270748v1:90528-90550 GCTAGCAAGGAATGCTGCTAAGG - Intergenic
1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG + Intergenic
1187555943 X:20351242-20351264 TCTGCCCTGGAATCCTGATGTGG + Intergenic
1187813467 X:23206393-23206415 ACGGGCCAAGCATGCTGCTGAGG - Intergenic
1189057282 X:37711387-37711409 TCTGGCAGGGAATGCAGCTCAGG + Intronic
1189465954 X:41277582-41277604 TCTGGAGGGGGATGCTGCTGGGG - Intergenic
1189469983 X:41306411-41306433 GCTGGTCAGGACTGCAGCTGTGG + Intergenic
1190101909 X:47528356-47528378 TATGCCCAGGAATCCTGCTGTGG - Intergenic
1199248323 X:145631816-145631838 CCTGGCCAGGCATGAGGCTGCGG - Intergenic
1199813831 X:151378970-151378992 TCTGGCAAGGAATGTTGGTTGGG - Intergenic
1199922990 X:152429322-152429344 TGAGGCCAGTAATGCTGCTTTGG - Intronic
1201260355 Y:12153193-12153215 TCTGGCAAGGCATTCTACTGGGG + Intergenic