ID: 1057477535

View in Genome Browser
Species Human (GRCh38)
Location 9:95415564-95415586
Sequence ATCTGGCCAGGAATGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057477535_1057477539 3 Left 1057477535 9:95415564-95415586 CCCAGCAGCATTCCTGGCCAGAT 0: 1
1: 0
2: 0
3: 20
4: 204
Right 1057477539 9:95415590-95415612 GCACCCCTAGCTTCTCTACCAGG 0: 1
1: 0
2: 0
3: 10
4: 110
1057477535_1057477544 29 Left 1057477535 9:95415564-95415586 CCCAGCAGCATTCCTGGCCAGAT 0: 1
1: 0
2: 0
3: 20
4: 204
Right 1057477544 9:95415616-95415638 AGATTGTGCCTCCACATCTTTGG 0: 1
1: 0
2: 0
3: 8
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057477535 Original CRISPR ATCTGGCCAGGAATGCTGCT GGG (reversed) Intergenic
901098714 1:6702629-6702651 TTCTGGGCAGGAAGGCTTCTGGG - Intergenic
901822742 1:11840551-11840573 AGATGGCCAGGAACACTGCTCGG - Exonic
902546935 1:17195979-17196001 CTCTGTCCAGGAGGGCTGCTGGG + Intergenic
902688751 1:18096492-18096514 ATGGGGCCAGGGATGCTGCCAGG + Intergenic
903545334 1:24120418-24120440 AACTGGCCAGGAATGGGGCAAGG + Exonic
903953182 1:27008239-27008261 CTCAGGACAGGAATGCTGCCTGG - Intronic
905619864 1:39435310-39435332 ATGTTTCCAGGAAGGCTGCTAGG + Intronic
908412017 1:63876233-63876255 AGTTATCCAGGAATGCTGCTTGG + Intronic
912249943 1:108000758-108000780 ATCTGGCCTGGAGTGCTCCAGGG - Intergenic
915040344 1:152963104-152963126 CTCTGGCCAGGAAACCTTCTGGG - Intergenic
915221921 1:154381596-154381618 ATCTAGCCAGGCATGGTGGTGGG - Intergenic
916688312 1:167167695-167167717 ATTGAGCCAGGAATGCTGATTGG + Intergenic
917418474 1:174836810-174836832 ATTTTGCCAGGAATCATGCTGGG - Intronic
917718079 1:177758215-177758237 ATCAGGTTAGGAAGGCTGCTGGG - Intergenic
918312085 1:183292246-183292268 TTCTGGCCAGACGTGCTGCTAGG - Intronic
918708849 1:187703281-187703303 ATGTGACCAGGAATGATGGTGGG + Intergenic
923534198 1:234836230-234836252 ATCTTGCCAGGAATACAGCTGGG - Intergenic
924002647 1:239571041-239571063 ATCTGGCAGGGAAGGCAGCTGGG - Intronic
924085298 1:240445244-240445266 ACATGGCCAGGAATGTTGCCTGG - Intronic
924453459 1:244199310-244199332 ATCAGTCCAGGAATCATGCTGGG - Intergenic
924652062 1:245938786-245938808 ATCTGGTCAGGAAAGAGGCTGGG - Intronic
1063016652 10:2084641-2084663 TTCTGGCATGGACTGCTGCTGGG - Intergenic
1063216586 10:3931087-3931109 AAAGGGCCAGGCATGCTGCTGGG - Intergenic
1064697460 10:17982708-17982730 AACTGCCCAGGGATGCTCCTAGG - Intronic
1065578675 10:27149925-27149947 AATTGGCCAGGAATGGTGTTGGG + Intronic
1066217110 10:33298601-33298623 ATCTGGCCAGGCATCGTCCTTGG + Intronic
1067003946 10:42643582-42643604 ATTTAGCCAGGCATGCTGGTGGG - Intergenic
1067580614 10:47443319-47443341 TTGAGGCCAGGAATGCTGCTGGG - Intergenic
1067676453 10:48383551-48383573 ATCTCAGCTGGAATGCTGCTTGG + Intronic
1068078172 10:52284595-52284617 ATGTGACTAGGAATGATGCTTGG + Intronic
1069064672 10:63930038-63930060 AACTGGCCAGGATTCCTGCCTGG - Intergenic
1069330527 10:67286934-67286956 ATCTGTCCAGGTTTGCAGCTAGG - Intronic
1069962594 10:72087556-72087578 ATCTCGCCTAGAAGGCTGCTGGG + Intronic
1073150564 10:101308648-101308670 ATTTGGCCTGACATGCTGCTGGG + Intergenic
1074204533 10:111271425-111271447 AGCTGGCAAGAAATGCTCCTGGG + Intergenic
1074403720 10:113163366-113163388 ATATAGCATGGAATGCTGCTTGG + Intronic
1074411274 10:113230635-113230657 ATTTGGTCAGGAGTGCAGCTTGG - Intergenic
1076671482 10:132123081-132123103 ATTTGGCCAAGAAAGCCGCTGGG - Intronic
1077321869 11:1946454-1946476 TGCTGGCCAGGAGGGCTGCTGGG - Intergenic
1077408502 11:2393029-2393051 ATCTGGCCAGGTAGGAGGCTGGG + Intronic
1078977393 11:16494700-16494722 ATATTGCCAGGCAGGCTGCTTGG - Intronic
1080318807 11:30981819-30981841 ATCTGGGCTGGAATGCTGCATGG + Intronic
1081212558 11:40354687-40354709 AGCTTGTCATGAATGCTGCTAGG + Intronic
1084029000 11:66469946-66469968 AACTAGCCAGGCATGCTGGTGGG - Intronic
1084415760 11:69032183-69032205 CTATGGTCAGGAAAGCTGCTAGG - Intergenic
1084687849 11:70707765-70707787 GTCTGTCCAGGAATCCAGCTTGG + Intronic
1086829373 11:91540762-91540784 ATCTAGCCAGGAATTCTGGATGG - Intergenic
1089387006 11:118074999-118075021 GTCTGGGCATGAAGGCTGCTGGG - Intergenic
1089670566 11:120054194-120054216 ACCTGCCCAGGAATGCTTCCTGG + Intergenic
1089892131 11:121892196-121892218 ATCTGGCCTGGGTTCCTGCTGGG + Intergenic
1090644025 11:128753014-128753036 CTCTGGCAAGGCAAGCTGCTTGG - Intronic
1202804885 11_KI270721v1_random:1767-1789 TGCTGGCCAGGAGGGCTGCTGGG - Intergenic
1091687930 12:2576896-2576918 ATGTGGCAAAGAATGCTGATAGG - Intronic
1094218411 12:27969865-27969887 ATCTGGCCAGCAGTTCTCCTGGG + Intronic
1094587559 12:31792086-31792108 AGCTGGCCACGAAAGCTGCCAGG - Exonic
1099145313 12:79036036-79036058 AACTGGACAGGAATGTTGATTGG - Intronic
1101124166 12:101614078-101614100 ATATGGGCAGGACTGCTGTTAGG - Intronic
1103040150 12:117688229-117688251 AACTGGCCAGGAATGGTGGTGGG + Intronic
1105542443 13:21326989-21327011 AGCTGGTCAGGAATGCTGGGAGG + Intergenic
1112921686 13:104621408-104621430 ATTTAGCCAGGCATGGTGCTGGG - Intergenic
1113389169 13:109879499-109879521 CACTGGCCAGGAGTCCTGCTTGG + Intergenic
1114412810 14:22516655-22516677 ATATGGCCAGAGATCCTGCTGGG - Intergenic
1116748956 14:48857539-48857561 ATCTGCCCACAAGTGCTGCTTGG + Intergenic
1119494171 14:75064188-75064210 ATCTGTCCAGGAACTCGGCTGGG + Intronic
1119924125 14:78475369-78475391 AAGTGGCCAGGAATTCTGCCTGG + Intronic
1122341117 14:101029140-101029162 ACCTTGCCTGGAAGGCTGCTTGG + Intergenic
1125403790 15:39332359-39332381 ATCTGGCCAGAAGAGCAGCTAGG + Intergenic
1129252100 15:74314738-74314760 CTCCTGGCAGGAATGCTGCTGGG - Intronic
1130646080 15:85728459-85728481 ACCTGGCTAGGCATACTGCTAGG + Intronic
1131423219 15:92324790-92324812 TTCTGGCTAGGAATGCTGATGGG - Intergenic
1132829327 16:1919722-1919744 CTCTGGCCAGGGCTGCTGCTGGG - Intergenic
1135730878 16:24894244-24894266 ATCTGCACAGAAATGCAGCTGGG - Intronic
1137584844 16:49658272-49658294 CTCTGGCCAGGCACGGTGCTGGG - Intronic
1139254198 16:65525369-65525391 ACGTGGCCAGGAAAGATGCTAGG + Intergenic
1139923888 16:70475217-70475239 ATGGGGCCAGTACTGCTGCTGGG + Intronic
1140672199 16:77290466-77290488 CTCTGGCCAGGCATTGTGCTAGG - Intronic
1142312405 16:89321513-89321535 CTCTGGCAAGGAGTGCTCCTGGG - Intronic
1142348627 16:89569835-89569857 AGCCGGCCTGGAAGGCTGCTCGG - Intergenic
1144787554 17:17840357-17840379 ACCTGGCCAGGAATGCCGCCAGG + Intergenic
1145019796 17:19420744-19420766 AATTGGCCAGGAGTGCTGGTGGG - Intergenic
1145210151 17:21006825-21006847 ATCAGGACAGGAATCCAGCTCGG - Intronic
1146516702 17:33495256-33495278 ATCTTGCCAGGGATTCTGATGGG + Intronic
1146561619 17:33874915-33874937 ATCAGGACAGGAATACTGCTGGG - Intronic
1147445286 17:40471509-40471531 GCCTGGCCAGGACTGCAGCTTGG + Intergenic
1147955414 17:44131107-44131129 ATGTGTTCAGCAATGCTGCTAGG + Intergenic
1148633645 17:49131040-49131062 ATGTGGCCAGTAATGGGGCTAGG - Intergenic
1150469497 17:65424795-65424817 ATGTGGCCAGGAAGGCAGCAGGG - Intergenic
1151287164 17:73121076-73121098 AACTAGCCAGGCATGGTGCTGGG - Intergenic
1151974385 17:77476101-77476123 ATTTGGCCAGCAAGGCTGATGGG + Intronic
1155333927 18:24745969-24745991 AGATGGCCAGGAATGCTACGAGG - Intergenic
1156456799 18:37299394-37299416 CTCTGGGCAGGGATGCTCCTGGG + Intronic
1157411237 18:47465104-47465126 ATGTGGGCTGGAAGGCTGCTAGG + Intergenic
1157926448 18:51772075-51772097 TTCTGGCCTGGAATGCCCCTGGG + Intergenic
1159852439 18:73540619-73540641 GTCTGGCCAGGAATATTACTTGG - Intergenic
1160376274 18:78414988-78415010 GCCTGGCCAGGACAGCTGCTAGG + Intergenic
1160811623 19:1015337-1015359 GTGAGGCCAGGGATGCTGCTCGG + Intronic
1161054012 19:2180921-2180943 CACTGGCCAGGAATGGAGCTGGG - Intronic
1163101583 19:15100454-15100476 ATCTAGCCAGGCATGGTGGTGGG + Intergenic
1163476699 19:17530695-17530717 ATCTGCCCAGGAGACCTGCTTGG - Intronic
1163613357 19:18312104-18312126 GCCTGGCTAGGAGTGCTGCTGGG - Intronic
1165574694 19:36804538-36804560 AATTGGCCAGGAATGGTGGTGGG + Intergenic
926245942 2:11122573-11122595 AACTGTCCAGGAATGCAGCCCGG + Intergenic
929353530 2:40991043-40991065 AGCTAGCCAGGAGTGCTGATTGG - Intergenic
930929443 2:56862548-56862570 AGCTGGCAGGGATTGCTGCTTGG - Intergenic
931359174 2:61563767-61563789 ATTTGGCCAGGTACTCTGCTTGG - Intergenic
932090878 2:68805250-68805272 ATCAGGCCAGGAAAGCAGGTGGG + Intronic
934131118 2:88950044-88950066 ATCTGGCCAGCAATGCATGTAGG - Intergenic
934133016 2:88967849-88967871 ATCTGGCCAGCAATGCATCCAGG - Intergenic
934708841 2:96502564-96502586 ACCTGGCCAGGCATGGGGCTGGG + Intronic
935871523 2:107455796-107455818 AGCTGGCAGGGAAAGCTGCTTGG + Intergenic
940225971 2:151401305-151401327 AACTGGCCAGGCATGGTGGTTGG - Intergenic
942241386 2:173965737-173965759 ATCCGGCCAAGACTGCTGCCGGG - Intergenic
942244949 2:173999277-173999299 TGCTGCCCAGGAGTGCTGCTGGG - Intergenic
942545888 2:177063280-177063302 ATTTGGCCAGCATTCCTGCTGGG - Intergenic
944221633 2:197310128-197310150 TTCTGGGCAGGACTCCTGCTAGG + Intronic
946298479 2:218806437-218806459 GAGAGGCCAGGAATGCTGCTAGG + Intronic
946352493 2:219164449-219164471 GACTGGCCAGGAAGGCTTCTTGG - Intronic
947298450 2:228660034-228660056 ATCTGTCCAGGAAAGCCACTTGG - Intergenic
947810122 2:232998803-232998825 ACCTGGCCCGGAGTCCTGCTAGG - Intronic
1170022038 20:11847268-11847290 AACTGGCCAGGCATGGTGGTGGG - Intergenic
1172129961 20:32649053-32649075 ACCTGGCAAGGAGTGCTGATTGG + Intergenic
1173280446 20:41622198-41622220 ATCTGGCCAGGAATGAGGAAAGG - Intergenic
1173923292 20:46761937-46761959 ATCTGGACTGCACTGCTGCTAGG + Intergenic
1174666886 20:52266503-52266525 ATATGGCCAGTGATGCTGGTGGG - Intergenic
1174938081 20:54894110-54894132 ATGTGGCCAGGCATGGTGGTTGG + Intergenic
1175214896 20:57386978-57387000 AGCTGTCCACCAATGCTGCTGGG + Intergenic
1175513039 20:59547502-59547524 AGCTGGCAAGGAGAGCTGCTTGG + Intergenic
1175775618 20:61651649-61651671 ATCTGGTCAGCATTGCTGCAGGG + Intronic
1176151686 20:63594630-63594652 ATCTGGCCAGCAATGCGGAGTGG + Intronic
1179961011 21:44767017-44767039 ATCTGGGAGGGAATGCTGTTGGG - Intergenic
1182804951 22:33061389-33061411 ATATGCACAGGAATGTTGCTTGG + Intergenic
1183548892 22:38469591-38469613 AGGTGGCCAGGAATGCTGAGTGG + Intronic
1183889003 22:40909926-40909948 TTCTGCCCAGGAAATCTGCTTGG - Intronic
1184652154 22:45924374-45924396 ATCAGGCCAGGGAAGCTGCTTGG - Intronic
1184682007 22:46077335-46077357 AACTGGCCAAGAAAGCTGCTTGG - Intronic
1184978002 22:48076732-48076754 ATGTGGCCAGGAATCCTGCGTGG - Intergenic
952757057 3:36878886-36878908 ATCTGGATAGGGAGGCTGCTGGG + Intronic
957621939 3:82604850-82604872 AGCTTGCCATGAATGCTGCCTGG - Intergenic
958471408 3:94525250-94525272 ATCTGTCCAGGAATGCCACAGGG + Intergenic
961068666 3:123899517-123899539 TTCTGGCCAGGACTGCTGGATGG - Intronic
961324946 3:126104397-126104419 GTCTGCCCAGGCAGGCTGCTTGG + Intronic
961642981 3:128376407-128376429 AGCTGGCCCAGAATGCTGCGGGG - Intronic
961738110 3:129014984-129015006 AGCTGTCCAGGAGTGGTGCTGGG - Intronic
963534378 3:146510086-146510108 ATCAGGCAAGCCATGCTGCTTGG + Intergenic
969416089 4:7060263-7060285 ATTTGGCCAGGAATTGAGCTTGG - Exonic
969651114 4:8468908-8468930 TTCCGGGCAGGGATGCTGCTTGG + Intronic
969710067 4:8837692-8837714 ATTTGACGAGGAATGTTGCTCGG + Intergenic
971870257 4:32226461-32226483 ATCTGGCCAGTAAATCTGCTAGG + Intergenic
972337929 4:38124658-38124680 ATTTTTCCAGGAATGCTCCTGGG - Intronic
976016454 4:80560606-80560628 AGCTTGTCATGAATGCTGCTTGG - Intronic
979929620 4:126614874-126614896 AACTAGCCAGGCATGGTGCTGGG + Intergenic
980077171 4:128306191-128306213 TGCTGGCCAGGAAGGCTACTTGG + Intergenic
980322332 4:131294070-131294092 ATCTGGCAAGGATAGCTGCTTGG - Intergenic
986410254 5:7472712-7472734 ATCTTGCTAAGAATTCTGCTTGG + Intronic
987276082 5:16364177-16364199 ATCAGCCCATGCATGCTGCTTGG - Intergenic
987837791 5:23183565-23183587 ATCACTCCAGGAATGCTGCATGG + Intergenic
989206505 5:38814471-38814493 AATTAGCCAGGAATGCTGGTGGG + Intergenic
989283820 5:39675676-39675698 AGATGGCCAGTAATGGTGCTAGG - Intergenic
989638655 5:43562270-43562292 AGATAGCCAGGAATGCTGCTTGG + Intergenic
991983484 5:72258204-72258226 CTCTGCCCAGGAAAGCTGCTGGG + Intronic
992577584 5:78133560-78133582 ATCTGTCCAGGGAAGCTGTTAGG + Intronic
993228844 5:85205003-85205025 AGCTGGCAGGGAAAGCTGCTTGG - Intergenic
993672633 5:90779755-90779777 ATCTGGGCAGAGATGCTGGTAGG - Intronic
995600596 5:113791181-113791203 CTCTGGCCTGCAAAGCTGCTAGG + Intergenic
996505397 5:124262640-124262662 ATTTGGCAATGAAAGCTGCTTGG + Intergenic
996594513 5:125185513-125185535 ATCTTGTCATGAATGCTGCCTGG - Intergenic
998096743 5:139400076-139400098 ATCTGGCCAGGCAGGCTGACAGG - Intronic
998327721 5:141296714-141296736 AGCTGGGCAGGAAGGCTCCTAGG - Intergenic
998918774 5:147044331-147044353 ATCTGGTCAGGAATGTTGTGAGG + Intronic
999463755 5:151780659-151780681 AACTGGCCAGGCATGGTGGTGGG - Intronic
999671947 5:153965903-153965925 ATGTGGCCAGGAGTCCTGCCTGG + Intergenic
1001234968 5:170021854-170021876 TTCTGGCCATCAAGGCTGCTTGG - Intronic
1002330802 5:178439207-178439229 ATCTGGCCATGCATGATGCATGG + Intronic
1002627738 5:180543205-180543227 ATTTAGCCAGGAGTGCTGGTAGG - Intronic
1003409577 6:5850832-5850854 AGCTGGTCAGGAATGCTCCGGGG - Intergenic
1006509089 6:34512162-34512184 ATCTGGCCCCAACTGCTGCTGGG - Intronic
1008880384 6:56375435-56375457 ATCTGGCCAGGAAGGAGGCAGGG - Intronic
1010658606 6:78542668-78542690 ATCTAGGCAGAAAGGCTGCTGGG + Intergenic
1011356705 6:86479000-86479022 ATCTGGTCAGGAACTCGGCTGGG - Intergenic
1015410744 6:132891356-132891378 AGCTGGCCATCAGTGCTGCTGGG - Intergenic
1016278383 6:142381970-142381992 AGCTGGCCAGTTCTGCTGCTGGG - Exonic
1022291274 7:29005971-29005993 CTCTCGCCAGGAGTGCTGCAAGG + Intronic
1024763511 7:52629194-52629216 ATCTGGCCTGAAATGTTGCCTGG + Intergenic
1025087131 7:56032509-56032531 ATTTAGCCAGGCATGCTACTGGG + Intronic
1027054400 7:75040066-75040088 GTCTGCCCAGGAGGGCTGCTTGG - Intronic
1027554682 7:79648475-79648497 AGCTGGCAGGGAAAGCTGCTTGG - Intergenic
1028246227 7:88481085-88481107 ATCTGGCCAGGCACACAGCTTGG + Intergenic
1029889861 7:103916177-103916199 ATCTGGGCAGGGCTACTGCTGGG + Intronic
1030421256 7:109309585-109309607 AGCTGGCAAGGAGAGCTGCTTGG + Intergenic
1032001385 7:128267666-128267688 GTCTGGCCAGGAGGGCTGCTTGG + Intergenic
1032227593 7:130045740-130045762 AACTAGCCAGGAATGGTGGTGGG + Intronic
1033389420 7:140912347-140912369 ATGTGGTTAGAAATGCTGCTAGG - Intronic
1033524688 7:142198849-142198871 ATCTGACCAGTAAAGCTGTTTGG - Intronic
1037501146 8:19486532-19486554 CTCTGGGCAGGAATGCTTCGAGG - Intronic
1040611748 8:48991354-48991376 ATGGAGCCAGGAACGCTGCTGGG + Intergenic
1044928625 8:97230795-97230817 ATATTGCCTGGAATGGTGCTGGG - Intergenic
1045584893 8:103523059-103523081 CTGTGGCCAGGAATGATGATGGG + Intronic
1045914092 8:107445640-107445662 ATCTAGCCAAGAGTCCTGCTGGG + Intronic
1047404608 8:124574738-124574760 ATTGGGCCAAGAATGCTGCCAGG + Intronic
1049396754 8:142404490-142404512 ACCAGCCCAGGAATGCTGGTGGG - Intergenic
1050073601 9:1841279-1841301 GTCTGCCCAGGAGGGCTGCTTGG - Intergenic
1051838389 9:21366096-21366118 ATTTGGCCAGGCATGGTGTTGGG - Intergenic
1052422600 9:28263136-28263158 ATCTGGCCAGGAATGGGTCTCGG - Intronic
1055201463 9:73667493-73667515 CTCTGTCCAGGAATGCTGGAGGG + Intergenic
1055338043 9:75252666-75252688 AGCTGGCAAGGAGAGCTGCTTGG + Intergenic
1056702993 9:88926088-88926110 CTCTGCCCAGGAAAGATGCTGGG - Intergenic
1057477535 9:95415564-95415586 ATCTGGCCAGGAATGCTGCTGGG - Intergenic
1057725176 9:97563447-97563469 ATCTTGCAAGGAATGGTGTTGGG - Intronic
1059145145 9:111893322-111893344 ATCTAGCCAGGCATGGTGGTGGG - Intergenic
1060395591 9:123314215-123314237 CTCTTGCCAGGAAAGTTGCTGGG + Intergenic
1061169172 9:128942062-128942084 CTCTGGAAAGCAATGCTGCTTGG - Intronic
1061217431 9:129229908-129229930 CTCTGCCCAGCAATGCTCCTGGG + Intergenic
1061908928 9:133712697-133712719 TTCCTGCCAGGAATGATGCTGGG - Exonic
1186622686 X:11258013-11258035 ATCTGGCCCTGACTTCTGCTTGG - Intronic
1187753872 X:22498218-22498240 ATCTTGCCAGAATTGCTGGTGGG + Intergenic
1188232003 X:27675771-27675793 TTTAGGCCAGGAATGCTGGTAGG + Intronic
1189181184 X:39006034-39006056 ATGTGGCCTGGAATGGAGCTAGG - Intergenic
1189356819 X:40316188-40316210 TGCTGTCCAGTAATGCTGCTAGG + Intergenic
1189465955 X:41277583-41277605 ATCTGGAGGGGGATGCTGCTGGG - Intergenic
1189561279 X:42193760-42193782 ATCAGGCCAGGCATGCTGGTGGG + Intergenic
1189656036 X:43245994-43246016 AATTAGCCAGGCATGCTGCTGGG - Intergenic
1190286846 X:48967068-48967090 ATCTTGCCAGCAATGGTGCTGGG + Exonic
1191643459 X:63452809-63452831 AGCTGGCAAGGAGAGCTGCTTGG + Intergenic
1199438987 X:147846814-147846836 ATCTGGACAGGAATGCAGCATGG - Intergenic
1199813832 X:151378971-151378993 GTCTGGCAAGGAATGTTGGTTGG - Intergenic