ID: 1057479229

View in Genome Browser
Species Human (GRCh38)
Location 9:95431162-95431184
Sequence GTTTGAAGACCTTTAAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057479224_1057479229 28 Left 1057479224 9:95431111-95431133 CCTTCAAGCTGATCAAAAACGAG No data
Right 1057479229 9:95431162-95431184 GTTTGAAGACCTTTAAAATAAGG No data
1057479222_1057479229 30 Left 1057479222 9:95431109-95431131 CCCCTTCAAGCTGATCAAAAACG No data
Right 1057479229 9:95431162-95431184 GTTTGAAGACCTTTAAAATAAGG No data
1057479227_1057479229 -10 Left 1057479227 9:95431149-95431171 CCTGACCTAATCAGTTTGAAGAC No data
Right 1057479229 9:95431162-95431184 GTTTGAAGACCTTTAAAATAAGG No data
1057479223_1057479229 29 Left 1057479223 9:95431110-95431132 CCCTTCAAGCTGATCAAAAACGA No data
Right 1057479229 9:95431162-95431184 GTTTGAAGACCTTTAAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057479229 Original CRISPR GTTTGAAGACCTTTAAAATA AGG Intergenic
No off target data available for this crispr