ID: 1057480184

View in Genome Browser
Species Human (GRCh38)
Location 9:95439206-95439228
Sequence CACAGCTTCCACTTACATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057480184_1057480188 9 Left 1057480184 9:95439206-95439228 CCGCCATGTAAGTGGAAGCTGTG No data
Right 1057480188 9:95439238-95439260 CAAAAGCATCTATTGACAAAAGG No data
1057480184_1057480189 10 Left 1057480184 9:95439206-95439228 CCGCCATGTAAGTGGAAGCTGTG No data
Right 1057480189 9:95439239-95439261 AAAAGCATCTATTGACAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057480184 Original CRISPR CACAGCTTCCACTTACATGG CGG (reversed) Intergenic
No off target data available for this crispr