ID: 1057481925

View in Genome Browser
Species Human (GRCh38)
Location 9:95451430-95451452
Sequence GTTCCCGCCCAGAAATATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057481925_1057481928 -7 Left 1057481925 9:95451430-95451452 CCCTGATATTTCTGGGCGGGAAC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1057481928 9:95451446-95451468 CGGGAACAACCCCGGCTGAGAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1057481925_1057481931 3 Left 1057481925 9:95451430-95451452 CCCTGATATTTCTGGGCGGGAAC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1057481931 9:95451456-95451478 CCCGGCTGAGAGGAGAGCGCTGG 0: 1
1: 1
2: 0
3: 10
4: 210
1057481925_1057481936 30 Left 1057481925 9:95451430-95451452 CCCTGATATTTCTGGGCGGGAAC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1057481936 9:95451483-95451505 CCAGCTGCCAGGTTTCCAGCTGG 0: 1
1: 0
2: 4
3: 37
4: 288
1057481925_1057481933 4 Left 1057481925 9:95451430-95451452 CCCTGATATTTCTGGGCGGGAAC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1057481933 9:95451457-95451479 CCGGCTGAGAGGAGAGCGCTGGG 0: 1
1: 0
2: 1
3: 12
4: 160
1057481925_1057481934 19 Left 1057481925 9:95451430-95451452 CCCTGATATTTCTGGGCGGGAAC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1057481934 9:95451472-95451494 GCGCTGGGATTCCAGCTGCCAGG 0: 1
1: 0
2: 1
3: 45
4: 552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057481925 Original CRISPR GTTCCCGCCCAGAAATATCA GGG (reversed) Intronic
901569046 1:10144322-10144344 TTTCCCTCCCAGAAAAATAAGGG + Intronic
905855665 1:41310474-41310496 GTTCCCTCCAAGGAAAATCAGGG + Intergenic
1073010640 10:100356584-100356606 GTTTCACCCCAGAAATACCAGGG - Exonic
1073367200 10:102952859-102952881 TTTCCAGCCCAGAACCATCAAGG - Intronic
1080463697 11:32477460-32477482 GATCTCGCCCAGAAATCACAGGG - Intergenic
1083608121 11:63991184-63991206 GTCCCCGCCCAGAGAGAACAGGG - Intronic
1087236123 11:95720323-95720345 GTTCCTGCCCAGAATTGTCTGGG + Intergenic
1100616123 12:96233082-96233104 GTACCTGGCCAGAAAGATCAAGG - Intronic
1101109528 12:101472425-101472447 GATCCCACCTAGAAATATCAGGG + Intergenic
1103964006 12:124626538-124626560 GTTCCAGCTCAGAAATCTCTGGG + Intergenic
1104010090 12:124924148-124924170 TTTCCAGCCAAGAAATCTCAAGG - Intergenic
1106542940 13:30706095-30706117 TTTTCCTCCCAGAAATAGCATGG + Intergenic
1106984258 13:35326367-35326389 TTTCCCTCCCAAAAATATCTAGG - Intronic
1107734336 13:43381704-43381726 GTTCCCATACATAAATATCAAGG + Intronic
1112915005 13:104537519-104537541 TTTCCCCCCCAAAAATATGAGGG - Intergenic
1120889813 14:89481876-89481898 TTTCACACCCAGAAATATCCTGG - Intronic
1131950925 15:97681069-97681091 GTTCCCGCCCAGACTAATGATGG + Intergenic
1139052334 16:63141070-63141092 TTTCCTGCTAAGAAATATCAAGG - Intergenic
1141489944 16:84366074-84366096 GCTCCAGCCCAGAGATGTCAAGG - Intergenic
1155467496 18:26154462-26154484 GTTTTCTTCCAGAAATATCAAGG + Intronic
1157309361 18:46540555-46540577 GTTCCTGCCCAGAAACTTCCAGG - Intronic
1160213002 18:76899179-76899201 GTTCCTGCAAAGGAATATCAGGG - Exonic
1162313360 19:9920929-9920951 TTTACCACCCAGAAATTTCAAGG - Intronic
1163745267 19:19043073-19043095 GATCCAGCCCACAAATATCTGGG - Intronic
1164990614 19:32679977-32679999 GTTCACGCCTATAAATCTCAGGG - Intergenic
926121941 2:10246053-10246075 GGTCACGGCCAGAAATTTCAAGG - Intergenic
942552021 2:177129643-177129665 GTTCCTGCCCAGCAACATGAAGG + Intergenic
1170564637 20:17591109-17591131 CTTCCCCCCCAGAAAAACCACGG + Intronic
1172514510 20:35523618-35523640 GTGCCAGCCCAGTGATATCAGGG + Intronic
1174501826 20:50990803-50990825 GTACCCACCCAAAAATGTCAAGG - Intergenic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1183051458 22:35265231-35265253 GTTCAAGCCCTGAAAGATCAAGG - Exonic
1185086593 22:48744204-48744226 GATCCCACCAAGAAATGTCAGGG - Intronic
960186093 3:114641271-114641293 GATGTCACCCAGAAATATCATGG - Intronic
961381264 3:126497942-126497964 GTTCCCTCCCAGAATTAGCTAGG + Intronic
962902221 3:139771520-139771542 GTTCTGGGCCAGAAATAGCAGGG + Intergenic
964157812 3:153606870-153606892 GTGCCCACCCAGGAACATCAGGG + Intergenic
965469652 3:169074989-169075011 GTTTCCTCCCATAACTATCACGG + Intergenic
968386839 4:148107-148129 CTGCCCGCCCAGAAATCTGAAGG - Intronic
973727890 4:53793910-53793932 TTTTCCTCCCAGAAATGTCAGGG - Intronic
976225694 4:82794404-82794426 GTTGGCTCCCAGAAACATCAAGG - Intronic
983100613 4:163621856-163621878 GTTTTCCCCCAGAAATATCCTGG - Intronic
984561979 4:181281580-181281602 GCTCCCGTCCAGAACTACCATGG + Intergenic
988844031 5:35111328-35111350 GTTACCATCCAGAAATCTCACGG - Intronic
989279555 5:39625451-39625473 GTTCCTGGTCATAAATATCAAGG + Intergenic
995037193 5:107547792-107547814 TTTCCCCCACAGAAATTTCACGG + Intronic
995797896 5:115961608-115961630 GTTCCAGCCCAGGAATTTCTGGG + Intergenic
1001385917 5:171338549-171338571 GTTCCTGACCAGAGTTATCAGGG + Intergenic
1005676599 6:28161715-28161737 GGCCCCGCCCAGAAATTTCCGGG + Intergenic
1013050572 6:106530655-106530677 ATCCCCCCCCAGAAATATCAGGG - Intronic
1013299107 6:108786579-108786601 GCTCCCGGCCAGAGATAGCACGG + Intergenic
1021640218 7:22729209-22729231 GTTCCAGCCCAGCATTAACAAGG + Intronic
1022873530 7:34504297-34504319 GTTCCGGCCTTGAAATACCATGG - Intergenic
1046942475 8:119944173-119944195 GCTCCCAGCCAGAAATAACAAGG - Intronic
1047877159 8:129151353-129151375 GTTCCCTTCCAGAACAATCATGG + Intergenic
1048261154 8:132946308-132946330 GCTGCCAGCCAGAAATATCATGG - Intronic
1048502326 8:134989447-134989469 GTTCCCACACAGAAAGAACAGGG - Intergenic
1048991236 8:139761445-139761467 TTTCCCGCCCAGAACTCTAAGGG - Intronic
1050489597 9:6173592-6173614 TTTCCAGCCCAGAAGGATCAGGG - Intergenic
1052162472 9:25282741-25282763 GTGAGCCCCCAGAAATATCATGG - Intergenic
1056950911 9:91040010-91040032 GTCCCTGCTCAGAAATAGCAGGG + Intergenic
1057481925 9:95451430-95451452 GTTCCCGCCCAGAAATATCAGGG - Intronic
1058323683 9:103667600-103667622 GTACTCTTCCAGAAATATCAAGG + Intergenic
1060638105 9:125215787-125215809 GTTCCTGCCAAGAAATAAAAAGG + Intronic
1061537098 9:131257012-131257034 GTTCGCACCCAGAAAGAACAGGG + Intergenic
1187643243 X:21318193-21318215 GTTCCAGCCCAGAGAGCTCAAGG + Intergenic
1200017724 X:153179222-153179244 GTTCCCGCCAGGAAACATCCGGG + Intergenic
1200317079 X:155145685-155145707 GCTCCAACCCAGATATATCATGG + Intronic
1201483299 Y:14464328-14464350 GTTTCTTTCCAGAAATATCAAGG + Intergenic