ID: 1057484669

View in Genome Browser
Species Human (GRCh38)
Location 9:95473171-95473193
Sequence GCATTTAGGCAGATGGATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057484665_1057484669 1 Left 1057484665 9:95473147-95473169 CCAGTGATTTCTGGTGTAGAGAT 0: 1
1: 0
2: 1
3: 12
4: 159
Right 1057484669 9:95473171-95473193 GCATTTAGGCAGATGGATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057484669 Original CRISPR GCATTTAGGCAGATGGATAA AGG Intronic
No off target data available for this crispr