ID: 1057486249

View in Genome Browser
Species Human (GRCh38)
Location 9:95486798-95486820
Sequence CAGGTGCAGCATTCGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057486249_1057486257 -4 Left 1057486249 9:95486798-95486820 CCAAGCTCCGAATGCTGCACCTG 0: 1
1: 0
2: 1
3: 8
4: 131
Right 1057486257 9:95486817-95486839 CCTGGGCTGGGAGGTGTCTCAGG No data
1057486249_1057486258 -3 Left 1057486249 9:95486798-95486820 CCAAGCTCCGAATGCTGCACCTG 0: 1
1: 0
2: 1
3: 8
4: 131
Right 1057486258 9:95486818-95486840 CTGGGCTGGGAGGTGTCTCAGGG No data
1057486249_1057486259 22 Left 1057486249 9:95486798-95486820 CCAAGCTCCGAATGCTGCACCTG 0: 1
1: 0
2: 1
3: 8
4: 131
Right 1057486259 9:95486843-95486865 ATACTAATAGTTACAGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057486249 Original CRISPR CAGGTGCAGCATTCGGAGCT TGG (reversed) Intronic
900490506 1:2946499-2946521 GAGGTGCAGCAGCCGGATCTGGG - Intergenic
900778898 1:4604499-4604521 CAGATGCAGCCTTGGGAGCTGGG + Intergenic
900855347 1:5177191-5177213 CTGGTGCAGCATCTGGATCTTGG - Intergenic
900884829 1:5407740-5407762 CAGGTGTGGCATGCGGGGCTGGG + Intergenic
903070478 1:20724618-20724640 CAGGTGCAGGATCTGGACCTGGG + Exonic
905474505 1:38216595-38216617 TAGGTGCAGCATCCGGAGCAAGG + Intergenic
907251520 1:53142638-53142660 CAGCTGCATCATTAGGAGCTGGG + Intergenic
907422025 1:54354053-54354075 CTGGTGCAGCATTGGGATGTAGG - Intronic
907732183 1:57077331-57077353 AAGGTGCAGTATTAGGAGCGGGG - Intronic
912527481 1:110294560-110294582 GTGGTGCAGGACTCGGAGCTGGG - Intergenic
915837571 1:159189779-159189801 CAGGAGCAGGATTTGGAGCTGGG + Exonic
917511487 1:175672760-175672782 CAGGTGCATCCTTCAGGGCTTGG + Intronic
919555409 1:199046464-199046486 CAGGTGCAGGCTACAGAGCTTGG - Intergenic
923000397 1:230002283-230002305 CAGGTGCAGCAGGAGGAGCAAGG + Intergenic
923198723 1:231691828-231691850 CAGGGGCAGCAGTCGGAACAGGG - Intronic
1070159592 10:73858175-73858197 CAGATGGAGCATTTGGTGCTAGG - Intronic
1071140863 10:82507693-82507715 CAGGTGCAGTATTTGGGACTAGG + Intronic
1071250374 10:83812364-83812386 AAGGTGCAGCATTCTCAGCCAGG + Intergenic
1071298128 10:84237395-84237417 CAGGTCCAGCAGCCGCAGCTTGG + Exonic
1073461360 10:103667624-103667646 CAGCTGCAGCAGTAGGGGCTGGG + Intronic
1074773591 10:116749562-116749584 CAGGTGCTGCGCTAGGAGCTGGG - Intergenic
1079203459 11:18394552-18394574 CGGCTGCAGCACTCTGAGCTGGG - Intronic
1079373188 11:19869690-19869712 CAGGTGCAGCCTAATGAGCTTGG - Intronic
1094672947 12:32588583-32588605 CAGGTGCAAGACTTGGAGCTTGG + Intronic
1096230869 12:49896108-49896130 CAGATGCAGCATTCGGAGAGGGG - Intronic
1096392657 12:51241073-51241095 CAGGTGCCAGATTTGGAGCTGGG + Intronic
1096465397 12:51845755-51845777 CAATGGCAGCAGTCGGAGCTTGG + Intergenic
1096595176 12:52690601-52690623 CAGGTACAGCAAAGGGAGCTTGG + Exonic
1097945630 12:65365214-65365236 CAGGTGCTGCATTCAGTGTTGGG + Intronic
1097968772 12:65610045-65610067 GAGCTGCAGTATTCTGAGCTTGG + Intergenic
1101145744 12:101839038-101839060 CAGGTGCACAATTGGGAGTTGGG + Intergenic
1106080386 13:26495830-26495852 CAGGAGCAGAATCCAGAGCTTGG + Intergenic
1110471522 13:75865179-75865201 CAGGTGAAGCATTGGGAACCTGG + Intergenic
1113665325 13:112137050-112137072 CAGCTCCAGCATGCTGAGCTAGG + Intergenic
1114648266 14:24267669-24267691 CAGGTGCAGCACACGCACCTCGG + Exonic
1117302776 14:54444913-54444935 CAGATGCAGCTTTCTGGGCTCGG + Intergenic
1120949082 14:90024313-90024335 CAGGTGCAGCAGGCAGAGGTGGG - Intronic
1122690560 14:103530196-103530218 CAGGTTCAGCGTCCAGAGCTCGG - Exonic
1122854056 14:104551708-104551730 CAGGTGAGGGATTCCGAGCTGGG + Intronic
1124360430 15:29032931-29032953 CAGCTGCAGCATGGGGAGCATGG + Intronic
1125017934 15:34955814-34955836 CAGGAGAATCATTCGAAGCTGGG + Intronic
1125163452 15:36675069-36675091 CAGCTGCAGTATCCTGAGCTTGG - Intronic
1129242052 15:74257626-74257648 CAGGTGCTGACTTCGGAGCATGG - Intronic
1129330400 15:74824159-74824181 CAGATGCAGCCATGGGAGCTGGG + Intronic
1129663710 15:77567488-77567510 CAGGTGAAGGACCCGGAGCTGGG + Intergenic
1130523057 15:84678763-84678785 CAGGTGGATCATTTGAAGCTGGG + Intronic
1130669096 15:85894548-85894570 CAGGTGCATCACTTGGGGCTAGG - Intergenic
1131540323 15:93270110-93270132 CAGGTGGAACATTCGGGGATGGG + Intergenic
1132809722 16:1791743-1791765 CAGGTCCAGCTCCCGGAGCTCGG + Exonic
1133285301 16:4687997-4688019 CAGGTCAAGCTTCCGGAGCTGGG + Intronic
1133472835 16:6092225-6092247 CATGTGAAGCATTTAGAGCTTGG - Intronic
1133539201 16:6732355-6732377 CAGATGCAGCATTCCTTGCTGGG + Intronic
1135423014 16:22317153-22317175 CAGGGGCAGCGTGCGCAGCTGGG - Exonic
1136846436 16:33580163-33580185 CAGGTGAATCATTCGAACCTGGG + Intergenic
1137938095 16:52655043-52655065 CAGATGCAGCTCTAGGAGCTGGG - Intergenic
1141957624 16:87383335-87383357 CAGGTGGAGGCCTCGGAGCTGGG - Intronic
1203108144 16_KI270728v1_random:1428818-1428840 CAGGTGAATCATTCGAACCTGGG + Intergenic
1143356231 17:6330894-6330916 CAGGTCCAGAATTCTGTGCTGGG - Intergenic
1144827272 17:18112633-18112655 CAGGTGGATCACTCGAAGCTAGG - Intronic
1147630796 17:41930207-41930229 CAGGTGGAACATTCGAGGCTGGG + Intronic
1149695234 17:58611313-58611335 CATGTGCAGCACTGGGAACTGGG + Exonic
1152411180 17:80124014-80124036 CAGCTGCAGCCTGCTGAGCTCGG - Intergenic
1154499460 18:14988009-14988031 CAGCAACAGCCTTCGGAGCTGGG + Intergenic
1157530049 18:48412488-48412510 CAGGGGCAGCATTTGGATCCAGG + Intergenic
1160741230 19:687015-687037 CGGGTCCAGCACTCGGACCTTGG + Exonic
1162063674 19:8111686-8111708 CAGGTGCAGCGGTAGGAGCCAGG + Exonic
1162251454 19:9447409-9447431 CAGGTGGAGAATTCAAAGCTTGG + Intergenic
1164533815 19:29069192-29069214 CAGGTTCAGCATGCAGAGCTTGG + Intergenic
933694481 2:85207332-85207354 CAGGTGCAGTGGACGGAGCTTGG - Intronic
934077468 2:88440348-88440370 CAGGTGGACCATTTGAAGCTGGG + Intergenic
935720120 2:105972611-105972633 CAGGTGCAGCAAAGGGAGCCAGG - Intergenic
936060243 2:109290689-109290711 CAGGTGCAGCAGTCAGGTCTGGG - Intronic
936823490 2:116552952-116552974 CAGGTGCAGCCCACGGAGCAGGG + Intergenic
937047211 2:118858257-118858279 CAGGTGAAGCCTTCAGAGCCAGG - Intergenic
937074170 2:119088934-119088956 CAGGTGCAGCATCCGCAGGGAGG + Intergenic
937873388 2:126802472-126802494 CGGGTGCAGCATGCAGGGCTTGG - Intergenic
944490315 2:200252086-200252108 CAGGTGCAGTTTTAGGTGCTGGG - Intergenic
944696069 2:202201530-202201552 CAGGTGCCAGATTTGGAGCTGGG - Intergenic
948586121 2:239020801-239020823 CTGGTGCAGCTTTCTGAGGTCGG - Intergenic
948969763 2:241415801-241415823 CAGGAGCAGGTTTCTGAGCTTGG + Intronic
1170898402 20:20436991-20437013 CACCGGCAGCATTCAGAGCTCGG - Intronic
1173582858 20:44159716-44159738 GAGCTGCAGCATGCGGCGCTTGG + Exonic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1178989152 21:37337419-37337441 CAGGTGCACCCCACGGAGCTGGG + Intergenic
1179158776 21:38874857-38874879 CAGGTGCAGTTTTCAGAGCAAGG + Intergenic
1179483272 21:41692107-41692129 GTGGTGCTGGATTCGGAGCTGGG - Intergenic
1179561639 21:42219448-42219470 CAGGGGCAGCGATCGGAGCCGGG - Intronic
1180231335 21:46428477-46428499 CAGGTGCGTCATGCGCAGCTGGG - Exonic
1181728037 22:24825139-24825161 CAGCTGGAGCATTCGGAGAGGGG + Intronic
1183868644 22:40723864-40723886 AATGGGCAGCATTCGGAGCGGGG + Intergenic
1185087052 22:48746651-48746673 CTGCTGCAGCATTCGGACCCGGG + Intronic
949519912 3:4841499-4841521 CAGGTGCGGCATTAGGTACTGGG + Intronic
953761214 3:45688766-45688788 CAGGTGCATCATTGGGAACAGGG + Intergenic
956106542 3:65824707-65824729 CTAATGCAGCATTCAGAGCTTGG + Intronic
956901942 3:73726143-73726165 CAGGTTCAACACTGGGAGCTGGG + Intergenic
968891959 4:3374234-3374256 CTGGCCCAGCACTCGGAGCTCGG - Intronic
971423585 4:26495223-26495245 CAGGTGCTGTATTTGGTGCTAGG + Intergenic
973848823 4:54940743-54940765 AAGGTGCAGCCTTCAGAGCGTGG + Intergenic
975491884 4:74998196-74998218 CAGTTGCAGCAGTTGGAGGTTGG + Intronic
976379830 4:84386749-84386771 GAGGTGCAGCATGAAGAGCTGGG - Intergenic
984828010 4:183945264-183945286 CAGTTGCAGAATTCGGGGGTTGG + Intronic
987105104 5:14630926-14630948 CAGGTGCAGCACTGGGGGCATGG - Intergenic
991958992 5:72022764-72022786 CAGGTCCAGCATTAGGATGTGGG + Intergenic
993744560 5:91580905-91580927 GAGGTGAAGCATTCTAAGCTTGG + Intergenic
996565535 5:124876502-124876524 CAGTTGCAGAATTGAGAGCTTGG - Intergenic
1002618431 5:180469589-180469611 GAGGTGCAGGAGTGGGAGCTGGG - Intergenic
1004168642 6:13278194-13278216 CAGGTGCATCCTTTGGACCTTGG - Intronic
1004265885 6:14148276-14148298 AAGGGGCAACATTGGGAGCTTGG + Intergenic
1015819534 6:137245723-137245745 CAGGTGCAGCAGGCGGGGATGGG - Intergenic
1019790058 7:3005949-3005971 CAGGTAAAGCATTCGAGGCTTGG - Intronic
1022527369 7:31047056-31047078 CAGGTGCTGCAGTCAAAGCTAGG - Intergenic
1025026999 7:55524863-55524885 CTGGTGCTGGATTTGGAGCTTGG - Intronic
1025219354 7:57092509-57092531 CAGGTGCAACAATGGGAGGTAGG + Intergenic
1025630146 7:63264080-63264102 CAGGTGCAACAATGGGAGGTAGG + Intergenic
1025652124 7:63479955-63479977 CAGGTGCAACAATGGGAGGTAGG - Intergenic
1030058909 7:105607544-105607566 CAGTAGCAGCATCAGGAGCTAGG + Exonic
1033621962 7:143069831-143069853 CAGGTCCTGCATTTGGACCTGGG - Intergenic
1033674014 7:143519932-143519954 CTGGTCCAGCATGCGGAGGTGGG - Intergenic
1033845599 7:145428119-145428141 CACGTGCAGCATTCCCAGCCTGG + Intergenic
1035336688 7:158133836-158133858 CAGCAGCCGCATTCGGAGCCCGG - Exonic
1035546181 8:483839-483861 CAGGGGCTGCATGCAGAGCTGGG + Intergenic
1035569864 8:665408-665430 CAGGTGCAACATTTGGTGCCCGG - Intronic
1036208866 8:6825910-6825932 CTGGAGCACCATGCGGAGCTTGG + Intronic
1037797570 8:22009668-22009690 CTGGTGCAGCATTCGTAGCTTGG - Intergenic
1038363002 8:26901689-26901711 CAGGTGCTGCTTTAGGTGCTGGG + Intergenic
1040625840 8:49149229-49149251 CTGGGGCAGCATTCTGAGGTGGG + Intergenic
1042335927 8:67630333-67630355 CAGGTGCAGCTTTGGGATGTGGG + Intronic
1048295186 8:133208838-133208860 CAGGTGCAGCACTAGGTGCTGGG - Intronic
1048885413 8:138905550-138905572 CAGGGGCAGAAATGGGAGCTTGG - Intronic
1049010743 8:139885594-139885616 CAGGTGCAGCAGGCGGATCTTGG - Intronic
1049341471 8:142114843-142114865 CAGGTGGCGCAGTCAGAGCTGGG - Intergenic
1052470873 9:28895058-28895080 CAGGTGCAGCAATAGAAACTAGG - Intergenic
1052558231 9:30048592-30048614 CAGGTGCAGTATTCGGGCCGAGG - Intergenic
1053350520 9:37410751-37410773 CAGGTGCAGGCGACGGAGCTGGG + Intergenic
1057367178 9:94433321-94433343 CAGGTGCAGCTTCTGGGGCTTGG + Intronic
1057486249 9:95486798-95486820 CAGGTGCAGCATTCGGAGCTTGG - Intronic
1057656156 9:96954749-96954771 CAGGTGCAGCTTCTGGGGCTTGG - Intronic
1060940601 9:127541002-127541024 CAGGTCCAGCATGGGGAGGTGGG + Intronic
1187472380 X:19580561-19580583 CAGCAGCAGCACTGGGAGCTTGG + Intronic
1190620797 X:52285005-52285027 CAGCTGCAGCCTGCCGAGCTCGG - Intergenic
1192211290 X:69129487-69129509 CAGGTTCAGCTTTCAGGGCTGGG - Intergenic