ID: 1057487088

View in Genome Browser
Species Human (GRCh38)
Location 9:95494183-95494205
Sequence TGGCACTGCCAGCAGCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 263}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057487088_1057487092 -1 Left 1057487088 9:95494183-95494205 CCCACCAGCTGCTGGCAGTGCCA 0: 1
1: 0
2: 3
3: 34
4: 263
Right 1057487092 9:95494205-95494227 ATCTGTTATCAGCCTTGCCCAGG No data
1057487088_1057487095 16 Left 1057487088 9:95494183-95494205 CCCACCAGCTGCTGGCAGTGCCA 0: 1
1: 0
2: 3
3: 34
4: 263
Right 1057487095 9:95494222-95494244 CCCAGGCTGCTCCCTCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057487088 Original CRISPR TGGCACTGCCAGCAGCTGGT GGG (reversed) Intronic
900564005 1:3323563-3323585 AGGCACTGGCGGCAGCTGGCGGG - Intronic
900933606 1:5751881-5751903 TTGCATTGCCAGGAGCTGGCAGG - Intergenic
901455886 1:9362497-9362519 TGGCCCTGCAAGCAGCTTGTGGG - Intronic
901636666 1:10673746-10673768 TGGCCCTGCCAGCAGGAGGTGGG + Intronic
901654383 1:10761005-10761027 TGGCAATGCCATCTGCTGATTGG - Intronic
901858505 1:12059412-12059434 TGGCCCAGGCAGCAGCTGGCAGG - Intergenic
903499732 1:23794423-23794445 TGGCACTGCCATTAGCTGCCTGG - Exonic
905908627 1:41638771-41638793 GGCCTTTGCCAGCAGCTGGTAGG + Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
905943515 1:41883216-41883238 TGGGACTGGCAGGAGCTGCTGGG + Intronic
906793147 1:48676235-48676257 TGGCTCTGCCAGAAGGTGGAAGG - Intronic
907973397 1:59407153-59407175 TGGCTCTGTCATCGGCTGGTTGG + Intronic
911220905 1:95244473-95244495 TGCCACTGCCAGTTTCTGGTTGG - Exonic
912487161 1:110038297-110038319 TGGCAGTGGCAGCAGCAGATGGG - Intronic
915580938 1:156813115-156813137 AGGGCCTGCCAGCAGTTGGTAGG + Intronic
916215434 1:162389551-162389573 TGGCACTGGAAACAGCTGGCTGG - Intergenic
921714066 1:218400732-218400754 TGGCACTGCCAGCTTGTGGTGGG + Intronic
922552592 1:226507031-226507053 TGTCACTGCAAACAGATGGTAGG - Intergenic
922754853 1:228090078-228090100 ACGCACTGCTAGCAGATGGTTGG + Intronic
923273562 1:232378459-232378481 TGGCTCTGCCCGGAGCTGGCTGG + Intergenic
923311175 1:232737046-232737068 AGGCACTGGCAGGAGCTGGGAGG + Intergenic
923509033 1:234633427-234633449 TGCCACTGGCATCAGCTGGAAGG - Intergenic
924194775 1:241594604-241594626 TTTCACTTCCAGCTGCTGGTAGG + Exonic
924929990 1:248721951-248721973 GGGCAAGGACAGCAGCTGGTAGG + Intronic
1063122965 10:3117578-3117600 TGGTACTCCCAGCCACTGGTGGG + Intronic
1063978893 10:11438002-11438024 TGCCACAGCCAGCATGTGGTCGG + Intergenic
1065058506 10:21872704-21872726 TGGAAGTGCCAGAAGGTGGTGGG + Intronic
1067793655 10:49305658-49305680 TGGACCTGCCACCAGCGGGTGGG + Intronic
1069511121 10:69043251-69043273 ACGCACCGCCAGCAGCTGGAAGG - Intergenic
1069604488 10:69731040-69731062 TGGCACTGCCACCGGCTTGCTGG - Intergenic
1070189325 10:74097274-74097296 TGCCACTGCCAACAGCTTGATGG - Exonic
1070517236 10:77219491-77219513 TGGCACTAACTGCAGCTGCTGGG - Intronic
1070679433 10:78438292-78438314 TCACACTGCCAGCAGGTGGCAGG - Intergenic
1071951936 10:90713167-90713189 TCACACAGCCAGCAGGTGGTTGG + Intergenic
1071978017 10:90975047-90975069 TGGCATTGCCTGCTGCTGCTTGG - Intergenic
1072903653 10:99431044-99431066 TGGCACCGCCAACACCTGCTCGG - Intergenic
1074240362 10:111632665-111632687 TTGCACAGCCAGCAGCTAGGAGG - Intergenic
1074452702 10:113572062-113572084 TTGCACAGCCACCAGCTGGATGG + Intronic
1074987363 10:118670137-118670159 TGACACTGCCAGCAGCTGTTGGG - Intergenic
1076272586 10:129166907-129166929 TGGCACAGCCACCAGCTTGGAGG - Intergenic
1076719306 10:132386308-132386330 TGGCAGAGGCAGCAGCTGGAAGG + Intergenic
1077343521 11:2036389-2036411 TGCCACTGACAGAAGCTGCTGGG - Intergenic
1077610168 11:3639095-3639117 TGGCCCTGCCAGGGCCTGGTGGG - Intronic
1079332009 11:19541468-19541490 GGGAACTGCCAGCCGATGGTTGG + Intronic
1080407338 11:31991128-31991150 TGTTTCTACCAGCAGCTGGTAGG + Intronic
1082801757 11:57420022-57420044 TGGCACTGCCTGCAGGTTATGGG - Intronic
1083271581 11:61575611-61575633 TGGCCATGCCAGCAGGTGGGAGG + Intronic
1083643204 11:64156756-64156778 TGGCTCTGCCACCAGCTGGCTGG + Intronic
1085120039 11:73961573-73961595 TGGCTCTGTCTGGAGCTGGTGGG - Intronic
1085241217 11:75058078-75058100 TGGCACTGGCAGCTGCTTCTGGG + Intergenic
1085392523 11:76189753-76189775 TGGCTCTGGCAGGTGCTGGTGGG - Intronic
1087221556 11:95551599-95551621 TAGCATTCCCAGCAGCTGGGAGG + Intergenic
1088094098 11:106077802-106077824 TCGCACTGCCAGCAGCCATTCGG - Exonic
1089339281 11:117746626-117746648 TGGGAGTGTCAGCAGCTGCTAGG - Intronic
1089697891 11:120227011-120227033 GGGCACTGCCCGCTGCTGGGCGG + Intronic
1202826507 11_KI270721v1_random:91578-91600 TGCCACTGACAGAAGCTGCTGGG - Intergenic
1091651550 12:2313975-2313997 AGGCACCGCCAGCAGCAGGCAGG - Intronic
1092008423 12:5088575-5088597 AGGCACTGCCAGCCGCAGGATGG - Intergenic
1092143689 12:6200654-6200676 TGGCACTGCCCGCACCGGGCAGG + Intronic
1092147962 12:6227872-6227894 TGGCCCAGCCAGCAGCTGACAGG + Intronic
1098762823 12:74446650-74446672 AGGAACTGGCAGCAGCTGCTTGG + Intergenic
1100934581 12:99648441-99648463 TGTCACAGACAGCAGCTGGTCGG - Exonic
1101529590 12:105562123-105562145 TGGCACTGCCATCAGACTGTAGG + Intergenic
1102080153 12:110091283-110091305 TGGCACTGACAGAGGCTGGTGGG + Intergenic
1103462621 12:121117200-121117222 TGGCACTGACAGAGGCTGGTGGG - Intergenic
1104763914 12:131314265-131314287 GGGCACAGCCTGCAGATGGTGGG - Intergenic
1104815583 12:131643791-131643813 GGGCACAGCCTGCAGATGGTGGG + Intergenic
1104901231 12:132190484-132190506 TGACCCCGCCAGCAGCGGGTGGG + Intergenic
1106833606 13:33611193-33611215 TGGCAGGGCCAGCTGCTGGCAGG + Intergenic
1108044495 13:46370580-46370602 AGGCACTGACAGGAGCTGTTGGG + Intronic
1108571922 13:51760335-51760357 AGGCAATTCCAGCAGCTGGCTGG - Exonic
1108596682 13:51955616-51955638 TGGCACTGACTGCAGTTGCTTGG - Intronic
1110005031 13:70255506-70255528 TGTCACTGCCGGCAGCTCGGCGG - Intergenic
1111711117 13:91815621-91815643 TGTCATTGACAGCAGCTGGAGGG - Intronic
1113570368 13:111349815-111349837 TGGAACTCTCAGCTGCTGGTAGG - Intergenic
1114905073 14:27118041-27118063 TGGCACTGCTAGCAGCTGATTGG + Intergenic
1117454266 14:55881994-55882016 TGGAACTGCCAGGCTCTGGTCGG + Intergenic
1117776654 14:59190090-59190112 TGGCTCTGCGGGCAGCTGGGAGG + Intronic
1118818741 14:69330975-69330997 TGGGACTACTAGCAGCTGGAGGG - Intronic
1119186923 14:72649847-72649869 TGTCTCTGCCAGCAGTTGGCTGG - Intronic
1121631177 14:95422898-95422920 TGGCAGTGCCAGCAGGTCTTAGG + Intronic
1122134252 14:99623751-99623773 TGGCACTGCCTGCTGCAGGCAGG - Intergenic
1122406749 14:101505369-101505391 TGGCAGAGCCGGCAGCTGGCTGG + Intergenic
1124813610 15:32966370-32966392 TGGGACAGCCAGCATTTGGTAGG + Intronic
1124986371 15:34620067-34620089 TGTCATTGACAGCAGCTGGAGGG - Intergenic
1128067518 15:64774444-64774466 TGGAACCACCAGCAGCTGGGTGG - Intronic
1129743781 15:78003788-78003810 GGCCACTGCAAGCAGCAGGTAGG + Intronic
1129818061 15:78573493-78573515 TGGCACAGTAAGCAGCTAGTTGG + Intronic
1130912783 15:88282526-88282548 TCCCAATGCCATCAGCTGGTAGG + Intergenic
1131036493 15:89225929-89225951 TGTCACTGCCACCAGCTGGGAGG + Intergenic
1131211855 15:90504405-90504427 TGGCACCACCAGCAGCAGCTGGG - Intergenic
1132892126 16:2209644-2209666 CTGCACTGCCAGCAGCTCCTGGG + Exonic
1133775125 16:8889670-8889692 TGGCACTGGCACCAGCTCGTGGG + Intergenic
1133913383 16:10086280-10086302 TGACACTGCCATCAGCTTCTGGG + Intronic
1134745656 16:16586289-16586311 TGATACTGACAGCAGCTGTTAGG - Intergenic
1135035747 16:19075527-19075549 TGGCACTGCTGGCATCTAGTTGG + Intronic
1135532887 16:23269729-23269751 TGGCTCAGCCAGTAGTTGGTGGG + Intergenic
1136142209 16:28294741-28294763 GGTCAGTGCCAGCAGCAGGTGGG - Intronic
1136240923 16:28943459-28943481 TGGCAATGTGAACAGCTGGTGGG - Intergenic
1138527908 16:57619636-57619658 GGCCCCAGCCAGCAGCTGGTGGG - Intronic
1138556488 16:57773958-57773980 TGGCACTGCCTGCTCTTGGTGGG + Intronic
1138983825 16:62302629-62302651 TGGCACTGCCAAAAGCCTGTGGG + Intergenic
1140107505 16:71974226-71974248 TGGCTCTGTCACCAGCTGGCTGG + Intronic
1140216019 16:73009674-73009696 TGGCCCTGCCATCTGCTGCTGGG - Intronic
1140631175 16:76854397-76854419 TGACACTGCCAGCTGGAGGTTGG - Intergenic
1141208988 16:81958732-81958754 TGGCTCTGCCAGCTGCTGGGAGG + Exonic
1141662285 16:85447906-85447928 TCTCACTGCCAGCTCCTGGTGGG + Intergenic
1141663661 16:85454682-85454704 CGGCACCGCCAGCAGCTGGGAGG - Intergenic
1141666682 16:85469399-85469421 TGCCCCTTCCAGCATCTGGTGGG - Intergenic
1141667465 16:85473318-85473340 GGGCAGGGCCAGGAGCTGGTGGG + Intergenic
1141774887 16:86116628-86116650 AGGCAGAGCCAGCAGCTGGAAGG + Intergenic
1142888923 17:2930316-2930338 TGGCACAGTGAGCAGCTGGTGGG - Intronic
1143098089 17:4489193-4489215 TTGCTCTGCCTGCAGCTGCTGGG - Intergenic
1143382788 17:6506994-6507016 TGGCACTGCCAGCCCAGGGTGGG + Intronic
1144022200 17:11247388-11247410 TGGCAGTTCCAGCATGTGGTAGG - Intronic
1145101787 17:20083221-20083243 TGGCCCCACCAGCAGCTGGCTGG - Intronic
1145200332 17:20938825-20938847 TGACAGTGCCAGCAGCAGGAGGG - Intergenic
1145990243 17:29074891-29074913 AGGGACTTCCAGTAGCTGGTGGG + Exonic
1146840968 17:36153921-36153943 TGGCACTGCCTGCACCTAGAGGG - Intergenic
1146907954 17:36629918-36629940 TTACAATGCCTGCAGCTGGTAGG + Intergenic
1147544777 17:41392964-41392986 TGGCACTGTGAACAGCTGGTGGG - Intronic
1148001167 17:44388080-44388102 TGCCACTCCCTGAAGCTGGTGGG + Intronic
1149382660 17:56109434-56109456 TGGTACTACTGGCAGCTGGTCGG - Intergenic
1149562634 17:57619643-57619665 TGGCTTTGCCTGCAGCTCGTGGG + Intronic
1150147401 17:62780512-62780534 GGGCACTGCCAGCTGCTTCTCGG + Intronic
1151472210 17:74325576-74325598 TGGCTCTTCCAGCAGCAGGCGGG + Intergenic
1151549627 17:74814611-74814633 TGGCAAAGCCAGCAGCATGTGGG - Intronic
1151770213 17:76155714-76155736 AGGCCCTGCCAGCAGCAGCTTGG - Exonic
1151882449 17:76903661-76903683 TGGCCCAGCCAACAGCTGGACGG + Intronic
1152800960 17:82330446-82330468 TGGCAGAGCCAGCACCTGGGTGG - Intronic
1152844022 17:82588350-82588372 TGGCACTGCAGGTAGCTGGGAGG + Intronic
1152879461 17:82806959-82806981 GGGGACTGCCTGCAGCGGGTGGG - Intronic
1152887530 17:82861110-82861132 TGTCACCGCCTGCTGCTGGTGGG + Intronic
1155518928 18:26649889-26649911 TGTCACTGCCATCTGCTGGATGG + Intronic
1158502220 18:58012907-58012929 TGGCACCACCAGGAGCTTGTTGG + Intergenic
1158919744 18:62178170-62178192 TGGCAATGGCAGCAGCTGTGGGG - Intronic
1159903026 18:74065932-74065954 AGGCAGTACCTGCAGCTGGTGGG + Intergenic
1160151859 18:76401586-76401608 GGGCTCTGCCAGCAGCTGCAGGG - Intronic
1160975789 19:1791847-1791869 TGTGGCTCCCAGCAGCTGGTGGG + Exonic
1162068479 19:8139845-8139867 TGGCCCTCCCAGCTGCTGGGAGG - Intronic
1162082462 19:8226462-8226484 GGGCCCAGCCAACAGCTGGTGGG + Intronic
1163311570 19:16518167-16518189 TGCTCCTGCCAGAAGCTGGTGGG - Exonic
1164294523 19:23898033-23898055 TGACAATCCCAACAGCTGGTGGG - Intergenic
1164783441 19:30911693-30911715 TGTATCTGCCAGCAGCTGCTAGG + Intergenic
1165084431 19:33333768-33333790 TAGCACTGCCACCAGATGATGGG - Intergenic
1165711372 19:38013142-38013164 TGGCGCTGCTAGCAGGTGCTGGG + Intronic
1166757530 19:45202607-45202629 TGGGGATGCCAGCAGCTGCTGGG + Intronic
1167124452 19:47539654-47539676 TGCCACTGCCCGCAGCTGCTGGG - Intronic
925285390 2:2712359-2712381 TCACACTGCCCGCACCTGGTCGG + Intergenic
925341368 2:3140083-3140105 AGGCACTGCCAGCTGCGGGTTGG - Intergenic
926286661 2:11494118-11494140 TTGCGCGGCCAGCAGATGGTAGG + Intergenic
927255065 2:21034058-21034080 TGGGTCTACCAGCAGCTTGTGGG + Intronic
927697959 2:25250854-25250876 TGGCAGCGGCAGCAGCAGGTGGG + Intronic
927741007 2:25569618-25569640 TGGAAATGCCAGCAGTTGGGTGG + Intronic
929588923 2:43132843-43132865 TCCCACTGACAGCAGCCGGTGGG + Intergenic
930345705 2:50178231-50178253 TGGCAATGCCAGCAACAGATTGG + Intronic
930858382 2:56043417-56043439 TAGCAATGCCCACAGCTGGTTGG - Intergenic
932429628 2:71666350-71666372 TGGCTCTGCCCCTAGCTGGTTGG - Intronic
934742174 2:96732294-96732316 CGGCACTGCCATCAGATGGTGGG - Intronic
934940748 2:98500278-98500300 TCCAACAGCCAGCAGCTGGTTGG + Intronic
936116501 2:109706990-109707012 TTGTACTGTGAGCAGCTGGTGGG - Intergenic
936285877 2:111181034-111181056 TGCCACTTCCAGCTTCTGGTGGG + Intergenic
936462618 2:112723862-112723884 TGGCACTGCAAGCAACAGGGAGG + Intronic
937366266 2:121264231-121264253 TGGGACTGCCTGGAGCAGGTAGG - Intronic
938066025 2:128282541-128282563 TGGCACTGCCAGCCCCTGCTGGG + Intronic
938556726 2:132431050-132431072 TGCTGCTGCCAGAAGCTGGTTGG + Intronic
942461537 2:176171823-176171845 GGGCACTGGCGGCAGCTGGCCGG - Exonic
942695372 2:178636681-178636703 TGGCACAGCCTTTAGCTGGTAGG + Exonic
944143565 2:196482475-196482497 TGGCACTGCCAGCTGGGAGTGGG + Intronic
944539743 2:200743907-200743929 TGGCAATGCCAGCACATGGACGG + Intergenic
944948638 2:204720679-204720701 TGGTACTGTCAGCAGGTGATTGG + Intronic
945037764 2:205718609-205718631 TTGCTCTTCCAGCAGCAGGTGGG - Intronic
945418147 2:209600431-209600453 GGGGACTGACAGCAGCTGGTGGG - Intronic
948400722 2:237683016-237683038 GAGCGCTGCCAGCATCTGGTGGG + Intronic
1169116520 20:3069720-3069742 GGGCACTCCCAGCAGCTGGGTGG + Intergenic
1169317140 20:4602135-4602157 AGGCACTGCCAGCTGACGGTAGG + Intergenic
1169926974 20:10793828-10793850 TGCCAATGCCCGCAGATGGTGGG + Intergenic
1170623403 20:18012383-18012405 TGGCACTGCCCGCAGTGGGTGGG - Intronic
1172930075 20:38580159-38580181 TGTGACTGCCAGCAGGTGGGTGG - Intergenic
1173654263 20:44688975-44688997 TGGCAATTCCAGGAGCTGGGAGG + Intergenic
1174577141 20:51544530-51544552 TGGCACTGCCACAAGATGTTGGG + Intronic
1174874707 20:54214781-54214803 TGGCACTGGCAGCAGCAGCTTGG - Intronic
1175382176 20:58570865-58570887 TGGGACTGTCAGTGGCTGGTGGG - Intergenic
1178891002 21:36521212-36521234 GGACCCTGCCAGGAGCTGGTTGG - Intronic
1179600898 21:42476633-42476655 TGGCACTGACAGCAGCTGAGGGG - Intronic
1180983027 22:19888254-19888276 GGCCATTGACAGCAGCTGGTGGG - Intronic
1181282148 22:21727836-21727858 TGGCACTGCCACCACCTGGCAGG + Intronic
1181563127 22:23717168-23717190 TGGCAGCGCAAGCAGCTGGACGG - Intergenic
1182282565 22:29225814-29225836 TGGCTGGGCCAGCAGCTGGGAGG + Intronic
1182486633 22:30643068-30643090 TGGCCCTGCCAACAGCTGCCTGG - Intronic
1183753087 22:39733330-39733352 TCCCACTGCCAGGAGCTGCTGGG - Intergenic
1184510757 22:44931921-44931943 TGGCACAGCCAGCAGCCTGCTGG + Intronic
1184671225 22:46013152-46013174 TTTCACTGCCAGCAGCTGGGAGG - Intergenic
1184690949 22:46117016-46117038 AGGCACTGCCACCAGCAGGAAGG + Intergenic
1184965033 22:47965479-47965501 TGGCAGGGCCTGTAGCTGGTGGG - Intergenic
950183421 3:10930696-10930718 TGGCACGGGCATCAGCTGCTTGG + Intronic
950615040 3:14151505-14151527 AGTCACTGCCAGCAGCAGGCTGG - Intronic
954156484 3:48687624-48687646 TGCCACTGGCAGCAGCTAATTGG - Intergenic
954750661 3:52811644-52811666 TGGCCCTGCCAGCACCTGCGGGG - Intergenic
955138608 3:56246328-56246350 GGGCACTGCTGGCAGCTTGTGGG - Intronic
955393300 3:58536662-58536684 TGCCACTGCCAGCATTTGCTAGG + Intronic
955469203 3:59268659-59268681 TGATTCTGCAAGCAGCTGGTGGG - Intergenic
955699470 3:61669794-61669816 TGGCACTGTGGACAGCTGGTTGG + Intronic
955807626 3:62753904-62753926 TTGCACAGCCAGGAGGTGGTGGG - Intronic
955967881 3:64407542-64407564 TGTCACAGCCAGCATCTAGTGGG + Intronic
956459204 3:69454520-69454542 CTGCACTCCCAGCAGCTGGCCGG + Intronic
960698182 3:120415839-120415861 TGGCACTGCCTGCTGATGGGTGG + Intronic
961825703 3:129597982-129598004 TGGCCCTGCCAGGTGCTGGCAGG - Intronic
962310614 3:134324398-134324420 TGGCCCTCCCAGCAACTGGGGGG + Intergenic
962820955 3:139046908-139046930 TGGCACTGTCATCCTCTGGTAGG + Intronic
962834507 3:139175764-139175786 TGGCATTGCCAGAAGCTAGTGGG - Intronic
963227283 3:142875261-142875283 TGGCACAGTCATCAGCTGCTGGG - Intronic
965687820 3:171324079-171324101 TGTCACTGCCAGTAGCTACTGGG - Intronic
966696355 3:182793769-182793791 TGGATCCGGCAGCAGCTGGTAGG + Exonic
966912278 3:184566223-184566245 TGGCCCTGCCAGCAGCCAGAAGG - Intronic
967968968 3:194985336-194985358 TGGCACTGCCGGCTGTTGGCTGG - Intergenic
969343468 4:6556915-6556937 AGGCATTGCCAGGAGCTGGGAGG - Intronic
972505125 4:39713723-39713745 TGTGACTGCCAGAAGCTGGGTGG - Intronic
979075287 4:116262806-116262828 TGGCTGTGCTAGCAGCTGATTGG - Intergenic
982110443 4:152048399-152048421 GGACACTGCCAGCAGCCTGTGGG - Intergenic
985570694 5:643289-643311 TGGCACTGCCAGGAGCTTTCTGG + Intronic
985576222 5:674649-674671 AGGACCTGCCAGCAGCTGGCTGG + Intronic
985608461 5:872086-872108 TGGCGGTGCCTGCAGCAGGTGGG + Intronic
985930953 5:3057612-3057634 GGGCACCTCCATCAGCTGGTAGG + Intergenic
990779760 5:59346738-59346760 TGGCACTGCCACTCACTGGTTGG - Intronic
991674097 5:69075148-69075170 GGGCACTGACGCCAGCTGGTTGG - Intergenic
992582623 5:78196845-78196867 AGTGACTGCCAGGAGCTGGTGGG + Intronic
993428204 5:87796983-87797005 TCCAAATGCCAGCAGCTGGTGGG + Intergenic
994451592 5:99950785-99950807 TGGGACTACCAGCAGCTGGAAGG + Intergenic
995097758 5:108259478-108259500 TAGTACAGCCAGCAGCTGGCAGG - Intronic
999272387 5:150304153-150304175 TGGCCCTTCAAGAAGCTGGTTGG - Intronic
1001087566 5:168711923-168711945 TGGCACAGCTAGCAGATGGCAGG - Intronic
1001742689 5:174067308-174067330 TGGCTCTGCCACTTGCTGGTGGG - Intronic
1002442227 5:179270442-179270464 TGGCCCTGGCAGAAGCTGGCAGG - Intronic
1003430949 6:6036879-6036901 TGGCTCTTCCAGCAGCAGGGAGG - Intergenic
1005091288 6:22059550-22059572 TGGCAATGACAGCAGCTCTTGGG - Intergenic
1006327607 6:33365754-33365776 TGGCACTGCCATTAGCTGCCTGG + Intergenic
1006615008 6:35320111-35320133 TCACACAGCCAGCAGCTGCTAGG - Intronic
1007225275 6:40309345-40309367 TGGCCTTGCCAGGAGCTGGGAGG - Intergenic
1007471595 6:42094197-42094219 AGGGACTGCCAGCTGCTGGCTGG + Intergenic
1008256718 6:49311000-49311022 TGCTAGAGCCAGCAGCTGGTAGG + Intergenic
1011284165 6:85706119-85706141 TGGGACTACCAGCAGCAGGAAGG - Intergenic
1014306512 6:119749191-119749213 TGCCCATGCCAGCAGCTAGTTGG - Intergenic
1017182206 6:151564479-151564501 TGGCAGTGGCAGCAGCAGGTGGG + Intronic
1017446017 6:154508638-154508660 TGGCATTGCCAGTACTTGGTAGG - Intronic
1019186422 6:170223272-170223294 TGGCACTGCCTGCGGGTGGAAGG - Intergenic
1019218295 6:170457524-170457546 TGGAGCTGTCAGCAGCTGCTGGG - Intergenic
1019606466 7:1912639-1912661 TGGGTCTGCCTGGAGCTGGTGGG - Intronic
1021579922 7:22141754-22141776 TGGCTCTGCCAGCAGTTCCTTGG + Intronic
1022478348 7:30726667-30726689 TGCCACTGTCACCAGCAGGTGGG + Intronic
1024705029 7:51947646-51947668 TGGCCCTGGCAGCAGGTGATGGG + Intergenic
1026583034 7:71633769-71633791 TGGATTTGCCAGCAGCTGGTAGG - Intronic
1027139570 7:75647702-75647724 TGGCCCTGGCAGCAGCTGGTTGG + Intronic
1029929375 7:104354479-104354501 CGGCACTGCCAGCAGATGTGTGG - Intronic
1032546740 7:132750276-132750298 TGTCAATGCAAGCAGCTGTTGGG - Intergenic
1033212675 7:139471758-139471780 AGGCACTGCAGGCAGCTGGCAGG + Intronic
1033516174 7:142108866-142108888 TGTCACAGCAAGCTGCTGGTTGG - Intergenic
1034200782 7:149281852-149281874 TGGCTGTCCCCGCAGCTGGTGGG - Exonic
1034245734 7:149643099-149643121 TGCCCCTGCCACCAGCTGGAGGG + Intergenic
1034644883 7:152636659-152636681 TGTGACTGCAAGCAGCTGTTGGG - Intergenic
1035022742 7:155808850-155808872 TGTCACCGCCAGCAGCCGGTGGG + Intronic
1036679513 8:10860823-10860845 TGTCACTGTCTGCTGCTGGTGGG - Intergenic
1037185262 8:16055122-16055144 TGGCACTGCCTGCAGCAGGGCGG + Intergenic
1037277774 8:17200095-17200117 GGGCACTGACAGCAGCTGCAGGG - Intronic
1038011627 8:23480875-23480897 TGTCACTGCCACCAGCAGGCAGG + Intergenic
1038521712 8:28238701-28238723 GTGCATTGCCAGCAGGTGGTGGG - Intergenic
1041739057 8:61139511-61139533 TGGCGCTGCCAGCAGCGGGAGGG + Intronic
1042359506 8:67866781-67866803 AGTCCCTGCCAGCAGCTGGATGG - Intergenic
1043542804 8:81281406-81281428 CGGCAGTGCCAGCAGCAGGTCGG - Intronic
1043664752 8:82794574-82794596 TGTCACTACCATCATCTGGTGGG + Intergenic
1043866406 8:85380150-85380172 TGGCACTGCCCATAGTTGGTTGG + Intronic
1048331715 8:133475238-133475260 CAGCACTGCCGGCAGCTGGCAGG + Intronic
1048938886 8:139379656-139379678 TGGCACTGTCTGCAGCAGCTGGG - Intergenic
1049103687 8:140597960-140597982 TGCCAGTGCCAGCAGATGCTTGG + Intronic
1049378327 8:142300027-142300049 TGGTGCTACCAGCAGGTGGTGGG - Intronic
1049553839 8:143272651-143272673 GGGCACAGCCAGCAGGTGGCAGG + Intronic
1055536402 9:77250456-77250478 TGGCACTCCTAGCATCTAGTGGG + Intronic
1055707379 9:79020465-79020487 TTGCTCTGGCTGCAGCTGGTGGG + Intergenic
1056068512 9:82961729-82961751 TTGCCCTGACAGCAGCAGGTTGG - Intergenic
1056560547 9:87726013-87726035 TGGCTGTGCCGGCAGCTGGGCGG - Exonic
1056801755 9:89697020-89697042 TGTCACTGGCAGCAGCTGCTAGG + Intergenic
1056832801 9:89930377-89930399 TGGCACAGACAGCAGCGGGAAGG + Intergenic
1057487088 9:95494183-95494205 TGGCACTGCCAGCAGCTGGTGGG - Intronic
1057819699 9:98321569-98321591 TGGCTCTGCCTGCTGCTGGTAGG - Intronic
1059488107 9:114643141-114643163 AAACACTGCCAGCAGCTGGCGGG - Exonic
1059646930 9:116276892-116276914 TGCCCCTCCCAGCAACTGGTGGG - Intronic
1060520665 9:124292234-124292256 TGGCTCAGCCACCTGCTGGTGGG + Intronic
1061249163 9:129416459-129416481 TGTCACCTCCAGAAGCTGGTGGG + Intergenic
1061486571 9:130923456-130923478 TGGCTCTTCCAGCAGGGGGTGGG - Intronic
1062044231 9:134417761-134417783 TGGCTCTGCCAGCAGCCGTGTGG + Intronic
1062116383 9:134811435-134811457 TGGCAATGCCAGCAGCTCTGGGG - Intronic
1062340048 9:136090156-136090178 TGGCACAGACACCAGCTGGGTGG + Intronic
1062416878 9:136455650-136455672 AGGCACCGCCAGCAGAGGGTTGG + Exonic
1062721398 9:138046095-138046117 TGGCTCTGCCAGTAGCAGGGAGG + Intronic
1190050759 X:47146870-47146892 GGGGACAGCCAGCAGCTTGTTGG + Intronic
1192220082 X:69191898-69191920 AGGCACTGCCCGCAGCCTGTTGG + Intergenic
1193906553 X:87252536-87252558 TGACATTGCCAGGAGCAGGTGGG + Intergenic
1197279832 X:124522251-124522273 AGGCACTGCTAAGAGCTGGTGGG + Intronic
1198240578 X:134781104-134781126 TGGCAGTGCCAACTGCTGGCTGG - Intronic
1199517804 X:148697759-148697781 TGGGTCTGCAAGCACCTGGTGGG + Intronic
1200114487 X:153764261-153764283 TGGCACCGCCAGCTGCTACTTGG + Exonic