ID: 1057489152

View in Genome Browser
Species Human (GRCh38)
Location 9:95508378-95508400
Sequence AGCCTCCGTCCCCGCGGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057489152_1057489164 15 Left 1057489152 9:95508378-95508400 CCGCCGCCGCGGGGACGGAGGCT 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1057489164 9:95508416-95508438 CGCGCTGCTGCCGCTGCTGCGGG 0: 1
1: 2
2: 20
3: 104
4: 865
1057489152_1057489163 14 Left 1057489152 9:95508378-95508400 CCGCCGCCGCGGGGACGGAGGCT 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1057489163 9:95508415-95508437 GCGCGCTGCTGCCGCTGCTGCGG 0: 1
1: 0
2: 3
3: 36
4: 312
1057489152_1057489165 22 Left 1057489152 9:95508378-95508400 CCGCCGCCGCGGGGACGGAGGCT 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1057489165 9:95508423-95508445 CTGCCGCTGCTGCGGGCTCCTGG 0: 1
1: 0
2: 3
3: 61
4: 404
1057489152_1057489158 -8 Left 1057489152 9:95508378-95508400 CCGCCGCCGCGGGGACGGAGGCT 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1057489158 9:95508393-95508415 CGGAGGCTTCCCGGGCGGCCCGG 0: 1
1: 0
2: 2
3: 17
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057489152 Original CRISPR AGCCTCCGTCCCCGCGGCGG CGG (reversed) Exonic
904778291 1:32925183-32925205 AGCCTCCTTTCCCTCGGCAGAGG - Intergenic
905145285 1:35883253-35883275 AGCCTCCGTTGCCGCCGCCGCGG - Exonic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
905890114 1:41513485-41513507 AGCCTCCGTGCCAGAGGCGGGGG + Exonic
907200986 1:52726629-52726651 AGCCTCCGTCCTGGGTGCGGCGG - Exonic
908849870 1:68364894-68364916 AGCCTCTGTCCCTGTGGAGGTGG + Intergenic
910960371 1:92755728-92755750 AGCCTCAGTCCCCTTGGCGTCGG - Intronic
912514842 1:110211024-110211046 AGCCGGCTTCCCCGCAGCGGCGG - Intergenic
916701653 1:167302075-167302097 AGACTCCGTCTCGGGGGCGGGGG - Intronic
917869640 1:179229748-179229770 GCCCTCCTTCCCCGCGGCGGAGG - Intergenic
923500044 1:234557028-234557050 AGCCTCTGTCCCCATGGAGGCGG + Intergenic
924502884 1:244653253-244653275 GGCCTCCGGCCCCGCGGAGACGG + Exonic
1063664093 10:8051497-8051519 AGCCCCGGGCCCTGCGGCGGCGG + Intergenic
1069722948 10:70561191-70561213 AGCCTCCATCCCCACGGCTGTGG + Intronic
1070394473 10:76000361-76000383 AGCCTCCCTCCCGGTGGAGGTGG + Intronic
1073325571 10:102642668-102642690 CGCCGCCTTCCTCGCGGCGGCGG + Intergenic
1076326439 10:129626986-129627008 TGCCTCCGTCCCCTCAGAGGCGG - Intronic
1077247712 11:1547460-1547482 AGCCGCCGTCCTCCCGGCTGCGG + Intergenic
1079251980 11:18793172-18793194 AGACTCCGTCTCGGGGGCGGGGG - Intergenic
1083665459 11:64271745-64271767 GTCCTCCGTCCCCGCGGGGTAGG + Exonic
1083965794 11:66042953-66042975 GGCCGCCATCCCCGCGGCGCTGG - Exonic
1084165291 11:67372602-67372624 TCGCTCCTTCCCCGCGGCGGGGG + Intronic
1084474137 11:69379110-69379132 ACCCTCCTTCCCCGCAGAGGTGG + Intergenic
1085399040 11:76224629-76224651 AGCCTCCCTCACCCCTGCGGCGG + Intergenic
1089993383 11:122882771-122882793 AGCCTCCGTGCCAGGGCCGGGGG + Exonic
1091170558 11:133516430-133516452 AGCCCCAGCCCCGGCGGCGGTGG - Intronic
1091700221 12:2654134-2654156 AGCCTCCCTCCCCGAGGCCTGGG + Intronic
1091823167 12:3491297-3491319 AGCCTCCGCGGCGGCGGCGGCGG - Exonic
1094466019 12:30754710-30754732 GGCCTCGGTCGGCGCGGCGGAGG - Intronic
1094514041 12:31117754-31117776 TGCCTCCGTCCCTGCGATGGGGG - Intergenic
1097383239 12:58920201-58920223 AGCCTCCGTGCGCGCGCCGCGGG - Exonic
1100390187 12:94140991-94141013 AGCCACAGTCCCCGTGGAGGAGG + Intergenic
1103321844 12:120096716-120096738 AGCCTCTGTCCCCGCTGCACAGG - Exonic
1104945815 12:132414480-132414502 GGCCTCCGTCCAGGCTGCGGTGG + Intergenic
1105914253 13:24897903-24897925 AGACTCCGTCCACGGGGCGGGGG - Intronic
1112507198 13:99982135-99982157 AGCCGCCGCCGCCGCCGCGGCGG - Exonic
1113709588 13:112454653-112454675 AGCCTCCATCCCCGCTCCAGAGG + Intergenic
1113885278 13:113655569-113655591 AGCCACCGTCCCCGTGGCCATGG + Intronic
1113946975 13:114049920-114049942 GGCCTCCGACCCCGCGGCATGGG - Intronic
1116895607 14:50312339-50312361 AGCCAGCGTCCCCGCGTCTGCGG - Exonic
1117072671 14:52069927-52069949 CGCCTCCGTGGCCGCGGGGGAGG - Intergenic
1117842119 14:59870641-59870663 AGCCGCCGTCGCCGCGCCGGGGG - Exonic
1119520155 14:75279138-75279160 AGCCCCCGGCCCCGCGGCGACGG - Intronic
1122231198 14:100306973-100306995 CGCCTGCGCGCCCGCGGCGGCGG + Intergenic
1122577215 14:102750030-102750052 GGCCTCGGTCCCCGCGGCCTCGG + Intergenic
1123464625 15:20506136-20506158 AGGCTGCGTCCGCGCGCCGGCGG - Intergenic
1123653491 15:22494905-22494927 AGGCTGCGTCCGCGCGCCGGCGG + Intergenic
1127579320 15:60323030-60323052 AGACTCCGTCTCAGGGGCGGGGG - Intergenic
1128423980 15:67521223-67521245 AGCCTGCGTCCCCGGCGCGGCGG + Exonic
1130224558 15:82046989-82047011 GGCCTGCGTCCCCGCGGTGGCGG - Intergenic
1132550641 16:552603-552625 AGCCTCCAGCCCCTCGGCAGGGG + Exonic
1132657381 16:1046924-1046946 AGCCACCGTCCCTGTGGCTGAGG - Intergenic
1132731707 16:1366131-1366153 AGCCTCGGTCCTCACGTCGGTGG + Intronic
1139570248 16:67807036-67807058 TGACTCCGCCCCCGCCGCGGGGG + Intronic
1142006113 16:87690286-87690308 AGCCCCGGTCCTCGGGGCGGTGG - Exonic
1142067669 16:88072101-88072123 CTCCTCGGACCCCGCGGCGGCGG + Exonic
1142130638 16:88430200-88430222 AGCCCCTGTCCCCAGGGCGGGGG - Exonic
1142763893 17:2055585-2055607 GGCTCCCCTCCCCGCGGCGGTGG - Intronic
1145191351 17:20843570-20843592 AGCCCCCAACACCGCGGCGGTGG - Intronic
1149481793 17:57009423-57009445 AGCCTCCATCCCCGCCGCCATGG - Intergenic
1149595440 17:57862191-57862213 AGCCTCCCTCCCCGTGGCAGTGG + Exonic
1149849395 17:60026306-60026328 GGTCTGCGGCCCCGCGGCGGGGG - Intergenic
1149860773 17:60120218-60120240 GGTCTGCGGCCCCGCGGCGGGGG + Intergenic
1152039108 17:77891823-77891845 AGCCTCCTTCCCTGTGGTGGCGG + Intergenic
1153911251 18:9708249-9708271 GGCCGCCGGCCCCGCCGCGGTGG - Exonic
1160763785 19:798178-798200 CCCCTCCGGCCCCGGGGCGGAGG - Intronic
1161040770 19:2109785-2109807 AGCCTCAGTCCCCGGGGCACAGG + Intronic
1161628769 19:5340888-5340910 TGCCCCCGACCCGGCGGCGGCGG - Intergenic
1161697209 19:5776084-5776106 AGCCTCCCTCCTCCCTGCGGAGG - Intronic
1161850858 19:6737349-6737371 CTCCCCCGTCCCCGAGGCGGTGG - Intronic
1162145595 19:8610913-8610935 AGCCCCCTCCCACGCGGCGGGGG - Intergenic
1163830182 19:19543826-19543848 AGCTGGCGTCCCCGCAGCGGGGG - Exonic
1165157224 19:33796046-33796068 AGCCCCGGGCGCCGCGGCGGCGG + Intronic
1166850409 19:45757430-45757452 AGCCTCCGTGGCAGCGGTGGCGG - Intronic
1167071765 19:47226268-47226290 GCCCTCAGTCCCCGCGGCCGCGG + Intronic
1167866987 19:52336657-52336679 AGCCCCAGTCCCGGCGGGGGAGG + Intronic
1168073069 19:53963337-53963359 CGCCGCCGCCCCCGCGGTGGGGG - Exonic
1168669244 19:58228794-58228816 AGCATGGGGCCCCGCGGCGGCGG - Intronic
925169691 2:1743524-1743546 AGCCTCAGTTCCCGCAGCCGCGG - Intronic
925385323 2:3458068-3458090 AGCCTCTGTCCCCGACGCAGAGG - Intronic
925607500 2:5673562-5673584 ATCCTCCGCCCGCGCGGCCGTGG - Intergenic
928478096 2:31652040-31652062 TGCCTCCGTCCTGGAGGCGGAGG - Intergenic
929442085 2:41972544-41972566 AGCTTCCGTCCCCTCAGTGGGGG - Intergenic
932495296 2:72143173-72143195 AGCCTCCCTCCCGGCGGCTTAGG + Intronic
936151527 2:110024639-110024661 ATCCTCCTTCCCCACCGCGGCGG - Intergenic
936193147 2:110346730-110346752 ATCCTCCTTCCCCACCGCGGCGG + Intergenic
940316900 2:152335818-152335840 AGCCTCCATTCCCGAGGGGGAGG + Intronic
943692287 2:190881187-190881209 TGCCGGCGTCCCCGAGGCGGGGG + Exonic
944495911 2:200306989-200307011 AGTCTCCGTCCCGGCCGCGCAGG - Intronic
948933620 2:241148971-241148993 CGCCCCCGACCCCGCGGCGCCGG + Intronic
1171768192 20:29301421-29301443 ACCCTCGGTCCCCACCGCGGAGG + Intergenic
1174375064 20:50121053-50121075 AGCCTCCCTCCCAGCTGCTGTGG - Intronic
1175392253 20:58634940-58634962 AGCATCAGCCCCTGCGGCGGAGG - Intergenic
1175790678 20:61738163-61738185 TGCCTCTGTCCCCCTGGCGGTGG - Intronic
1175913824 20:62416542-62416564 AGCCTCCCTCCCCTGGGCTGGGG - Intronic
1176173647 20:63707741-63707763 AGCCTCAGACCTGGCGGCGGCGG - Intronic
1178314534 21:31557990-31558012 AGCATCCCGCCCCGCGGCCGGGG + Intronic
1178513827 21:33229894-33229916 CGCCCCCGCCCCCGCGCCGGCGG + Intronic
1180342204 22:11628242-11628264 GCCCTCCGTCCCCACCGCGGAGG - Intergenic
1181120907 22:20668385-20668407 AGCCCCCAACACCGCGGCGGTGG + Intergenic
1181669661 22:24420269-24420291 ATCCTCAGGCCCGGCGGCGGCGG - Intronic
1182586512 22:31346714-31346736 AGCCCCCGGCCCCGCGGGCGGGG - Intergenic
1183501446 22:38181904-38181926 AGGCTCCGCCCCCGCGCCCGAGG + Intronic
950633733 3:14300848-14300870 AACCTCCGTCCCCACGGTTGGGG - Intergenic
952167224 3:30763490-30763512 AGACTCCGTCTCGGCGGCGGGGG + Intronic
952382606 3:32816940-32816962 AGCCTCCATCCCCGAGGCTCGGG + Intergenic
954176233 3:48847814-48847836 CCCGTCGGTCCCCGCGGCGGCGG - Exonic
955769250 3:62372555-62372577 AGCCTCCGGGCGGGCGGCGGCGG - Exonic
956761300 3:72447208-72447230 CGCCTCCGCCCTCGCGGCGCCGG - Intergenic
966362785 3:179148404-179148426 AGCCCCAGTCCCAGCGGCCGCGG - Intronic
967904100 3:194486790-194486812 CTCCTCCGCGCCCGCGGCGGCGG + Intronic
968491583 4:893167-893189 TGCCTCCCTCCCCTCTGCGGGGG + Intronic
968491616 4:893287-893309 TGCCTCCCTCCCCTCTGCGGGGG + Intronic
968526282 4:1059197-1059219 AGCCTCCGTGCCCCCGACAGGGG + Intronic
968748751 4:2375202-2375224 AGCCACCTTCCCCGAGGCTGCGG - Intronic
972511482 4:39771502-39771524 CGCTTCCGGCCCCGCGGGGGTGG - Intronic
973755484 4:54069412-54069434 AGCTTCTGTCCCCGCGGAGTCGG + Intronic
976251145 4:83053127-83053149 AGCCTCAGTCCCAGCGGAGGTGG + Intronic
981067229 4:140498085-140498107 CGCCTCCTTTCCCGCCGCGGGGG - Intronic
987050469 5:14143764-14143786 GTCCTCCGGCCCCGCCGCGGCGG + Exonic
989043131 5:37249359-37249381 AGCCTGCGTCCTGGCGACGGCGG + Exonic
990955154 5:61332814-61332836 GGCCCCGGCCCCCGCGGCGGCGG - Exonic
991917114 5:71616111-71616133 AGCTTCTGTCCCCGCGGAGTGGG - Intronic
994947760 5:106417436-106417458 AGCCTCCGACTGCCCGGCGGGGG + Intergenic
998119158 5:139561747-139561769 CGCCCCCGTCCCCGCCCCGGGGG + Exonic
998228899 5:140346729-140346751 AGCCCCCGACCCCGCGGGCGCGG + Intergenic
998385163 5:141753312-141753334 AACGTCCCTCCCCGGGGCGGGGG + Intergenic
1002204592 5:177554083-177554105 AGCCTCCATTCCCGCCCCGGGGG + Intronic
1003640586 6:7871986-7872008 AGCTTCTGTCCTGGCGGCGGGGG + Intronic
1005303776 6:24495063-24495085 CGCCTCCGCCCCCGCGCCGGCGG + Exonic
1006051365 6:31347364-31347386 AGCCTCTGTCCCCACGGAGATGG - Intronic
1007431525 6:41779914-41779936 GACCTCCGACCCCGCGGCCGCGG - Intronic
1015251833 6:131135536-131135558 AGCCGCAGCCCCCGCGGCAGCGG - Intergenic
1017073848 6:150600161-150600183 GCCCTCCGTCCCCACTGCGGAGG - Intronic
1018946962 6:168354511-168354533 AGCCTCCCTCCCCTGGGCTGCGG + Intergenic
1019195644 6:170280969-170280991 TGCCACCGTGCCCGCGGCGGGGG + Intergenic
1019330947 7:460550-460572 TTCCTCTGTCCCCGCGGGGGAGG - Intergenic
1022103806 7:27184599-27184621 AGCCGCCGCCGCCGCCGCGGAGG + Exonic
1026628079 7:72014166-72014188 AGCCTCCGTCCCCTGGGCTCCGG + Intronic
1034264131 7:149773128-149773150 CGCCTGGGTCCCCGCGGCGCGGG - Exonic
1035023169 7:155810382-155810404 ACCCTCACTCCCCGCGGAGGAGG - Intronic
1040423334 8:47260729-47260751 AGCTTCCTTCCCCGGGGCTGGGG - Exonic
1049762177 8:144336610-144336632 AGGCTCCGCCGCGGCGGCGGGGG - Intergenic
1049788393 8:144462214-144462236 ATCCTGGGGCCCCGCGGCGGGGG + Intronic
1057489152 9:95508378-95508400 AGCCTCCGTCCCCGCGGCGGCGG - Exonic
1057489276 9:95508882-95508904 ACCCTCGGACCCCGCGGCGGCGG - Intronic
1058467564 9:105244659-105244681 AGCCGCCGTCGCCGCCGCCGGGG + Exonic
1060200943 9:121651569-121651591 AGCAGCCGGCCCCGCGGCGGGGG - Intronic
1061837142 9:133336813-133336835 AGACTCCGTCACCGGGGTGGGGG - Intergenic
1062021243 9:134320332-134320354 GGCCTTCGTCCCCGGGGCCGCGG + Intronic
1187888131 X:23907952-23907974 AGGCTCCGCCCCTGCGCCGGCGG + Exonic
1190881686 X:54496128-54496150 AGCCTGGGTCTCGGCGGCGGCGG + Exonic
1200092489 X:153642449-153642471 AGCCGCCGCCGCCGCTGCGGAGG - Intergenic
1200884973 Y:8258685-8258707 AGCCTCTGTCCCCTATGCGGGGG - Intergenic