ID: 1057489486

View in Genome Browser
Species Human (GRCh38)
Location 9:95510395-95510417
Sequence CCAGTGTCACCAAGGCATCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057489481_1057489486 -10 Left 1057489481 9:95510382-95510404 CCCGACACCGCGTCCAGTGTCAC 0: 1
1: 0
2: 0
3: 4
4: 49
Right 1057489486 9:95510395-95510417 CCAGTGTCACCAAGGCATCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057489486 Original CRISPR CCAGTGTCACCAAGGCATCC CGG Intronic
No off target data available for this crispr