ID: 1057490645

View in Genome Browser
Species Human (GRCh38)
Location 9:95517047-95517069
Sequence CCCCGCGGCCGTGTTTGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 47}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057490630_1057490645 5 Left 1057490630 9:95517019-95517041 CCGCGAGCCTAGCCACCCTCTCC 0: 1
1: 0
2: 1
3: 27
4: 222
Right 1057490645 9:95517047-95517069 CCCCGCGGCCGTGTTTGCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 47
1057490631_1057490645 -2 Left 1057490631 9:95517026-95517048 CCTAGCCACCCTCTCCCCGCCCC 0: 1
1: 2
2: 15
3: 166
4: 1497
Right 1057490645 9:95517047-95517069 CCCCGCGGCCGTGTTTGCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 47
1057490632_1057490645 -7 Left 1057490632 9:95517031-95517053 CCACCCTCTCCCCGCCCCCCGCG 0: 1
1: 0
2: 35
3: 356
4: 2682
Right 1057490645 9:95517047-95517069 CCCCGCGGCCGTGTTTGCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 47
1057490626_1057490645 21 Left 1057490626 9:95517003-95517025 CCTGCCCGGCGAGCTCCCGCGAG 0: 1
1: 0
2: 1
3: 11
4: 92
Right 1057490645 9:95517047-95517069 CCCCGCGGCCGTGTTTGCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 47
1057490627_1057490645 17 Left 1057490627 9:95517007-95517029 CCCGGCGAGCTCCCGCGAGCCTA 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1057490645 9:95517047-95517069 CCCCGCGGCCGTGTTTGCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 47
1057490629_1057490645 6 Left 1057490629 9:95517018-95517040 CCCGCGAGCCTAGCCACCCTCTC 0: 1
1: 0
2: 0
3: 9
4: 191
Right 1057490645 9:95517047-95517069 CCCCGCGGCCGTGTTTGCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 47
1057490634_1057490645 -10 Left 1057490634 9:95517034-95517056 CCCTCTCCCCGCCCCCCGCGGCC 0: 1
1: 3
2: 16
3: 156
4: 1491
Right 1057490645 9:95517047-95517069 CCCCGCGGCCGTGTTTGCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 47
1057490625_1057490645 22 Left 1057490625 9:95517002-95517024 CCCTGCCCGGCGAGCTCCCGCGA 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1057490645 9:95517047-95517069 CCCCGCGGCCGTGTTTGCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 47
1057490628_1057490645 16 Left 1057490628 9:95517008-95517030 CCGGCGAGCTCCCGCGAGCCTAG 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1057490645 9:95517047-95517069 CCCCGCGGCCGTGTTTGCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057490645 Original CRISPR CCCCGCGGCCGTGTTTGCGG GGG Intronic
904034098 1:27549928-27549950 CCCCCCGGCCCCGTTTGCGTGGG + Exonic
910760961 1:90730555-90730577 CTCCGCGGCCGCGTTGGCTGCGG - Intergenic
916233402 1:162561845-162561867 GCGCGTGGCCGTGTGTGCGGTGG - Intronic
1067669501 10:48306563-48306585 CCCCGGGGCCCGGATTGCGGGGG - Intergenic
1072555982 10:96513894-96513916 CCCGGCGGCCGAGGCTGCGGCGG + Exonic
1083696722 11:64448484-64448506 CCCCGCAGGCGTGTCTGCTGTGG + Intergenic
1085666329 11:78418004-78418026 CCCCGCGTCCGCGTGCGCGGCGG - Intronic
1102235408 12:111291419-111291441 CCCCGTGCCTGTGTTTGAGGCGG + Exonic
1103780732 12:123397167-123397189 CTCCGCTGCCATGTTTGCAGAGG + Intronic
1108555189 13:51584640-51584662 CCCCGCGGCGCGGTTGGCGGCGG + Exonic
1115028071 14:28766118-28766140 CACCGCTGGCGTGTGTGCGGGGG - Intergenic
1123060437 14:105591963-105591985 CCGCGCAGCCGTGTCTGCTGGGG - Intergenic
1123084914 14:105712934-105712956 CCGCGCGGCCGTGTCTGCTGGGG - Intergenic
1132398298 15:101489778-101489800 GCCCGCGGCGGTGTTGGCGGCGG - Exonic
1132735818 16:1385361-1385383 CCACCTGGCCGTGTTTGCAGCGG - Intronic
1133053924 16:3135305-3135327 CCCCGCGGGCGAGGCTGCGGTGG + Exonic
1139459374 16:67109809-67109831 TCCCGCCGCCGTCTCTGCGGAGG - Intergenic
1141178275 16:81734886-81734908 CCCAGCGGGCGTGTGTGTGGTGG + Intergenic
1142030022 16:87833817-87833839 CCCCCCGGCCCTGTGTGCAGCGG - Intronic
1142764696 17:2058568-2058590 CCCCGAGGGCGTCTTTGCTGTGG + Exonic
1146167435 17:30600839-30600861 CCCGGCGGCGGGGTTGGCGGGGG - Intergenic
1147931456 17:43984004-43984026 CGGCGCGGCCGTGGTTCCGGCGG - Intronic
1152918056 17:83052074-83052096 CCCCGCGGCGGCGTCTACGGGGG - Intergenic
1160508853 18:79442180-79442202 CCCAGAGGCCGTGCTTGCCGTGG - Intronic
1163365331 19:16872935-16872957 CCCCGTGGGTGTGTCTGCGGTGG + Intronic
1163657815 19:18557931-18557953 CGCCGGGGCCGAGTTTGGGGTGG + Intronic
1165742956 19:38214372-38214394 CACCGGGGCCGTGGTTGCAGGGG - Intronic
930022050 2:47007572-47007594 CCCCGCAGCCGTCTCTGAGGAGG + Intronic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
939519829 2:143215726-143215748 CTCCGCAGAAGTGTTTGCGGAGG - Intronic
942046149 2:172100575-172100597 CCCCGCCGCCGTGATGGTGGTGG + Exonic
1180157254 21:45983643-45983665 CCGTGCGGCAGTGTTTGGGGGGG + Intronic
1183482991 22:38075136-38075158 CCCCGCGGCTGTGGTGCCGGGGG + Exonic
1185054290 22:48569955-48569977 CACCGCGGCTATGTGTGCGGGGG - Intronic
954116780 3:48470986-48471008 CCACCCTGCCGTGTTTGCAGAGG + Intronic
954879441 3:53823620-53823642 CCACGCGGCCGCGTCTGGGGTGG - Exonic
982256551 4:153456798-153456820 CACCGCGCCCGGCTTTGCGGCGG + Intergenic
985253046 4:188042370-188042392 CCCCACGGCGGTGTCTGCGGTGG - Intergenic
999727199 5:154446534-154446556 CTCCGCGGCCGCGCTTGCCGCGG - Exonic
1002608973 5:180401411-180401433 CCCAGCCGCCGTGTTTGGGTGGG + Intergenic
1002661244 5:180792344-180792366 CCCCGCGGCCGTGGTGGTGGAGG - Exonic
1006547482 6:34791997-34792019 CCCGCCGGCCTTGCTTGCGGCGG - Intronic
1018023865 6:159789289-159789311 CCCCGAGGCCCTTTCTGCGGAGG + Intronic
1019428188 7:987115-987137 CCCCGAGGGCCTGTTTGCTGAGG + Exonic
1019636679 7:2079742-2079764 CCCTGCGGCCGTGCTTGCCGGGG - Intronic
1021969629 7:25952707-25952729 CCCGGCGGCAGTGCTTGCTGGGG + Intergenic
1041068068 8:54101592-54101614 CCGCGCGGCCGGGTCCGCGGGGG - Intronic
1049584774 8:143427834-143427856 CCCCTCGGCCTTCTTTGCCGAGG + Intronic
1049776829 8:144409780-144409802 CTCCGCGGGAGTGTTGGCGGCGG - Intronic
1057490645 9:95517047-95517069 CCCCGCGGCCGTGTTTGCGGGGG + Intronic
1059414393 9:114154278-114154300 CCCCGCAGCCGTGGGCGCGGGGG - Intergenic
1185877728 X:3713669-3713691 CCCCGCGGCCGGGTTAGGGCGGG - Intergenic
1200216539 X:154370580-154370602 CTCCGCGGCTGTGCTCGCGGTGG - Intronic