ID: 1057490769

View in Genome Browser
Species Human (GRCh38)
Location 9:95517623-95517645
Sequence CACCCAAGGCCGCCTGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057490769_1057490774 0 Left 1057490769 9:95517623-95517645 CCTGTGCCAGGCGGCCTTGGGTG No data
Right 1057490774 9:95517646-95517668 ACTGGCCTAAACCTAGGAGCTGG No data
1057490769_1057490773 -6 Left 1057490769 9:95517623-95517645 CCTGTGCCAGGCGGCCTTGGGTG No data
Right 1057490773 9:95517640-95517662 TGGGTGACTGGCCTAAACCTAGG No data
1057490769_1057490779 12 Left 1057490769 9:95517623-95517645 CCTGTGCCAGGCGGCCTTGGGTG No data
Right 1057490779 9:95517658-95517680 CTAGGAGCTGGTGGGTCGCGCGG No data
1057490769_1057490776 4 Left 1057490769 9:95517623-95517645 CCTGTGCCAGGCGGCCTTGGGTG No data
Right 1057490776 9:95517650-95517672 GCCTAAACCTAGGAGCTGGTGGG No data
1057490769_1057490775 3 Left 1057490769 9:95517623-95517645 CCTGTGCCAGGCGGCCTTGGGTG No data
Right 1057490775 9:95517649-95517671 GGCCTAAACCTAGGAGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057490769 Original CRISPR CACCCAAGGCCGCCTGGCAC AGG (reversed) Intergenic
No off target data available for this crispr