ID: 1057490776

View in Genome Browser
Species Human (GRCh38)
Location 9:95517650-95517672
Sequence GCCTAAACCTAGGAGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057490766_1057490776 8 Left 1057490766 9:95517619-95517641 CCGTCCTGTGCCAGGCGGCCTTG No data
Right 1057490776 9:95517650-95517672 GCCTAAACCTAGGAGCTGGTGGG No data
1057490763_1057490776 17 Left 1057490763 9:95517610-95517632 CCTACTGTGCCGTCCTGTGCCAG No data
Right 1057490776 9:95517650-95517672 GCCTAAACCTAGGAGCTGGTGGG No data
1057490772_1057490776 -10 Left 1057490772 9:95517637-95517659 CCTTGGGTGACTGGCCTAAACCT No data
Right 1057490776 9:95517650-95517672 GCCTAAACCTAGGAGCTGGTGGG No data
1057490769_1057490776 4 Left 1057490769 9:95517623-95517645 CCTGTGCCAGGCGGCCTTGGGTG No data
Right 1057490776 9:95517650-95517672 GCCTAAACCTAGGAGCTGGTGGG No data
1057490761_1057490776 21 Left 1057490761 9:95517606-95517628 CCCACCTACTGTGCCGTCCTGTG No data
Right 1057490776 9:95517650-95517672 GCCTAAACCTAGGAGCTGGTGGG No data
1057490762_1057490776 20 Left 1057490762 9:95517607-95517629 CCACCTACTGTGCCGTCCTGTGC No data
Right 1057490776 9:95517650-95517672 GCCTAAACCTAGGAGCTGGTGGG No data
1057490760_1057490776 30 Left 1057490760 9:95517597-95517619 CCAAATGCTCCCACCTACTGTGC No data
Right 1057490776 9:95517650-95517672 GCCTAAACCTAGGAGCTGGTGGG No data
1057490771_1057490776 -2 Left 1057490771 9:95517629-95517651 CCAGGCGGCCTTGGGTGACTGGC No data
Right 1057490776 9:95517650-95517672 GCCTAAACCTAGGAGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057490776 Original CRISPR GCCTAAACCTAGGAGCTGGT GGG Intergenic
No off target data available for this crispr