ID: 1057490779

View in Genome Browser
Species Human (GRCh38)
Location 9:95517658-95517680
Sequence CTAGGAGCTGGTGGGTCGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057490772_1057490779 -2 Left 1057490772 9:95517637-95517659 CCTTGGGTGACTGGCCTAAACCT No data
Right 1057490779 9:95517658-95517680 CTAGGAGCTGGTGGGTCGCGCGG No data
1057490763_1057490779 25 Left 1057490763 9:95517610-95517632 CCTACTGTGCCGTCCTGTGCCAG No data
Right 1057490779 9:95517658-95517680 CTAGGAGCTGGTGGGTCGCGCGG No data
1057490761_1057490779 29 Left 1057490761 9:95517606-95517628 CCCACCTACTGTGCCGTCCTGTG No data
Right 1057490779 9:95517658-95517680 CTAGGAGCTGGTGGGTCGCGCGG No data
1057490766_1057490779 16 Left 1057490766 9:95517619-95517641 CCGTCCTGTGCCAGGCGGCCTTG No data
Right 1057490779 9:95517658-95517680 CTAGGAGCTGGTGGGTCGCGCGG No data
1057490762_1057490779 28 Left 1057490762 9:95517607-95517629 CCACCTACTGTGCCGTCCTGTGC No data
Right 1057490779 9:95517658-95517680 CTAGGAGCTGGTGGGTCGCGCGG No data
1057490771_1057490779 6 Left 1057490771 9:95517629-95517651 CCAGGCGGCCTTGGGTGACTGGC No data
Right 1057490779 9:95517658-95517680 CTAGGAGCTGGTGGGTCGCGCGG No data
1057490769_1057490779 12 Left 1057490769 9:95517623-95517645 CCTGTGCCAGGCGGCCTTGGGTG No data
Right 1057490779 9:95517658-95517680 CTAGGAGCTGGTGGGTCGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057490779 Original CRISPR CTAGGAGCTGGTGGGTCGCG CGG Intergenic
No off target data available for this crispr