ID: 1057498027

View in Genome Browser
Species Human (GRCh38)
Location 9:95575484-95575506
Sequence CCATTCCCACGTGTGGTGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057498027_1057498035 11 Left 1057498027 9:95575484-95575506 CCGTGCACCACACGTGGGAATGG No data
Right 1057498035 9:95575518-95575540 GCAGCCCGGCCTCTCTGTTGTGG No data
1057498027_1057498039 24 Left 1057498027 9:95575484-95575506 CCGTGCACCACACGTGGGAATGG No data
Right 1057498039 9:95575531-95575553 TCTGTTGTGGCTTCTCCGTGTGG No data
1057498027_1057498033 -3 Left 1057498027 9:95575484-95575506 CCGTGCACCACACGTGGGAATGG No data
Right 1057498033 9:95575504-95575526 TGGGAGCAGGGCCTGCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057498027 Original CRISPR CCATTCCCACGTGTGGTGCA CGG (reversed) Intergenic
No off target data available for this crispr