ID: 1057498030

View in Genome Browser
Species Human (GRCh38)
Location 9:95575491-95575513
Sequence CCTGCTCCCATTCCCACGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057498030_1057498033 -10 Left 1057498030 9:95575491-95575513 CCACACGTGGGAATGGGAGCAGG No data
Right 1057498033 9:95575504-95575526 TGGGAGCAGGGCCTGCAGCCCGG No data
1057498030_1057498039 17 Left 1057498030 9:95575491-95575513 CCACACGTGGGAATGGGAGCAGG No data
Right 1057498039 9:95575531-95575553 TCTGTTGTGGCTTCTCCGTGTGG No data
1057498030_1057498035 4 Left 1057498030 9:95575491-95575513 CCACACGTGGGAATGGGAGCAGG No data
Right 1057498035 9:95575518-95575540 GCAGCCCGGCCTCTCTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057498030 Original CRISPR CCTGCTCCCATTCCCACGTG TGG (reversed) Intergenic
No off target data available for this crispr