ID: 1057498033

View in Genome Browser
Species Human (GRCh38)
Location 9:95575504-95575526
Sequence TGGGAGCAGGGCCTGCAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057498027_1057498033 -3 Left 1057498027 9:95575484-95575506 CCGTGCACCACACGTGGGAATGG No data
Right 1057498033 9:95575504-95575526 TGGGAGCAGGGCCTGCAGCCCGG No data
1057498030_1057498033 -10 Left 1057498030 9:95575491-95575513 CCACACGTGGGAATGGGAGCAGG No data
Right 1057498033 9:95575504-95575526 TGGGAGCAGGGCCTGCAGCCCGG No data
1057498024_1057498033 6 Left 1057498024 9:95575475-95575497 CCACAGAGACCGTGCACCACACG No data
Right 1057498033 9:95575504-95575526 TGGGAGCAGGGCCTGCAGCCCGG No data
1057498023_1057498033 15 Left 1057498023 9:95575466-95575488 CCTGGAAGTCCACAGAGACCGTG No data
Right 1057498033 9:95575504-95575526 TGGGAGCAGGGCCTGCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057498033 Original CRISPR TGGGAGCAGGGCCTGCAGCC CGG Intergenic
No off target data available for this crispr