ID: 1057498034

View in Genome Browser
Species Human (GRCh38)
Location 9:95575515-95575537
Sequence CAACAGAGAGGCCGGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057498034_1057498039 -7 Left 1057498034 9:95575515-95575537 CCTGCAGCCCGGCCTCTCTGTTG No data
Right 1057498039 9:95575531-95575553 TCTGTTGTGGCTTCTCCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057498034 Original CRISPR CAACAGAGAGGCCGGGCTGC AGG (reversed) Intergenic
No off target data available for this crispr