ID: 1057498039

View in Genome Browser
Species Human (GRCh38)
Location 9:95575531-95575553
Sequence TCTGTTGTGGCTTCTCCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057498034_1057498039 -7 Left 1057498034 9:95575515-95575537 CCTGCAGCCCGGCCTCTCTGTTG No data
Right 1057498039 9:95575531-95575553 TCTGTTGTGGCTTCTCCGTGTGG No data
1057498027_1057498039 24 Left 1057498027 9:95575484-95575506 CCGTGCACCACACGTGGGAATGG No data
Right 1057498039 9:95575531-95575553 TCTGTTGTGGCTTCTCCGTGTGG No data
1057498030_1057498039 17 Left 1057498030 9:95575491-95575513 CCACACGTGGGAATGGGAGCAGG No data
Right 1057498039 9:95575531-95575553 TCTGTTGTGGCTTCTCCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057498039 Original CRISPR TCTGTTGTGGCTTCTCCGTG TGG Intergenic
No off target data available for this crispr