ID: 1057500100

View in Genome Browser
Species Human (GRCh38)
Location 9:95590031-95590053
Sequence CAGAGAAGACAGAAGGACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057500100_1057500102 -5 Left 1057500100 9:95590031-95590053 CCTCGGTCCTTCTGTCTTCTCTG No data
Right 1057500102 9:95590049-95590071 CTCTGTGTACACCACCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057500100 Original CRISPR CAGAGAAGACAGAAGGACCG AGG (reversed) Intergenic
No off target data available for this crispr