ID: 1057501173

View in Genome Browser
Species Human (GRCh38)
Location 9:95597605-95597627
Sequence CTGGCCTACCTGGCTGTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057501165_1057501173 7 Left 1057501165 9:95597575-95597597 CCACTGATGTCTGGCTTGACGCT No data
Right 1057501173 9:95597605-95597627 CTGGCCTACCTGGCTGTAGGTGG No data
1057501163_1057501173 21 Left 1057501163 9:95597561-95597583 CCTCTTGATCAGGTCCACTGATG No data
Right 1057501173 9:95597605-95597627 CTGGCCTACCTGGCTGTAGGTGG No data
1057501162_1057501173 22 Left 1057501162 9:95597560-95597582 CCCTCTTGATCAGGTCCACTGAT No data
Right 1057501173 9:95597605-95597627 CTGGCCTACCTGGCTGTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057501173 Original CRISPR CTGGCCTACCTGGCTGTAGG TGG Intergenic
No off target data available for this crispr