ID: 1057502387

View in Genome Browser
Species Human (GRCh38)
Location 9:95605921-95605943
Sequence GCTCCAAGAAGGAGACCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057502387_1057502397 19 Left 1057502387 9:95605921-95605943 CCCGAGGGTCTCCTTCTTGGAGC No data
Right 1057502397 9:95605963-95605985 CCCTGGCTCTGGGTGGGCCCTGG No data
1057502387_1057502390 2 Left 1057502387 9:95605921-95605943 CCCGAGGGTCTCCTTCTTGGAGC No data
Right 1057502390 9:95605946-95605968 TTTTCTGAATGACCATACCCTGG No data
1057502387_1057502392 9 Left 1057502387 9:95605921-95605943 CCCGAGGGTCTCCTTCTTGGAGC No data
Right 1057502392 9:95605953-95605975 AATGACCATACCCTGGCTCTGGG No data
1057502387_1057502393 12 Left 1057502387 9:95605921-95605943 CCCGAGGGTCTCCTTCTTGGAGC No data
Right 1057502393 9:95605956-95605978 GACCATACCCTGGCTCTGGGTGG No data
1057502387_1057502394 13 Left 1057502387 9:95605921-95605943 CCCGAGGGTCTCCTTCTTGGAGC No data
Right 1057502394 9:95605957-95605979 ACCATACCCTGGCTCTGGGTGGG No data
1057502387_1057502391 8 Left 1057502387 9:95605921-95605943 CCCGAGGGTCTCCTTCTTGGAGC No data
Right 1057502391 9:95605952-95605974 GAATGACCATACCCTGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057502387 Original CRISPR GCTCCAAGAAGGAGACCCTC GGG (reversed) Intergenic
No off target data available for this crispr