ID: 1057502550

View in Genome Browser
Species Human (GRCh38)
Location 9:95607230-95607252
Sequence GGTTTGGCTTGGAACAGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057502550_1057502557 1 Left 1057502550 9:95607230-95607252 CCACTGCTGTTCCAAGCCAAACC No data
Right 1057502557 9:95607254-95607276 GGCTCAGCTTCTCACCACGAGGG No data
1057502550_1057502559 18 Left 1057502550 9:95607230-95607252 CCACTGCTGTTCCAAGCCAAACC No data
Right 1057502559 9:95607271-95607293 CGAGGGAACCCCAGCTGCCCTGG No data
1057502550_1057502560 25 Left 1057502550 9:95607230-95607252 CCACTGCTGTTCCAAGCCAAACC No data
Right 1057502560 9:95607278-95607300 ACCCCAGCTGCCCTGGTTGTAGG No data
1057502550_1057502556 0 Left 1057502550 9:95607230-95607252 CCACTGCTGTTCCAAGCCAAACC No data
Right 1057502556 9:95607253-95607275 CGGCTCAGCTTCTCACCACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057502550 Original CRISPR GGTTTGGCTTGGAACAGCAG TGG (reversed) Intergenic
No off target data available for this crispr