ID: 1057504513

View in Genome Browser
Species Human (GRCh38)
Location 9:95621659-95621681
Sequence GATATGCAACTCCTCCTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057504513_1057504515 26 Left 1057504513 9:95621659-95621681 CCAGTAAGGAGGAGTTGCATATC No data
Right 1057504515 9:95621708-95621730 ATGATTAAGCTGAATGAGGAAGG No data
1057504513_1057504514 22 Left 1057504513 9:95621659-95621681 CCAGTAAGGAGGAGTTGCATATC No data
Right 1057504514 9:95621704-95621726 AGACATGATTAAGCTGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057504513 Original CRISPR GATATGCAACTCCTCCTTAC TGG (reversed) Intergenic
No off target data available for this crispr