ID: 1057504515

View in Genome Browser
Species Human (GRCh38)
Location 9:95621708-95621730
Sequence ATGATTAAGCTGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057504513_1057504515 26 Left 1057504513 9:95621659-95621681 CCAGTAAGGAGGAGTTGCATATC No data
Right 1057504515 9:95621708-95621730 ATGATTAAGCTGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057504515 Original CRISPR ATGATTAAGCTGAATGAGGA AGG Intergenic
No off target data available for this crispr