ID: 1057506450

View in Genome Browser
Species Human (GRCh38)
Location 9:95637485-95637507
Sequence CTGAGCACTGGGAATGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057506444_1057506450 -10 Left 1057506444 9:95637472-95637494 CCACTGATGGTCCCTGAGCACTG No data
Right 1057506450 9:95637485-95637507 CTGAGCACTGGGAATGTGGCTGG No data
1057506443_1057506450 -3 Left 1057506443 9:95637465-95637487 CCTCTCACCACTGATGGTCCCTG No data
Right 1057506450 9:95637485-95637507 CTGAGCACTGGGAATGTGGCTGG No data
1057506441_1057506450 3 Left 1057506441 9:95637459-95637481 CCATAACCTCTCACCACTGATGG No data
Right 1057506450 9:95637485-95637507 CTGAGCACTGGGAATGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057506450 Original CRISPR CTGAGCACTGGGAATGTGGC TGG Intergenic
No off target data available for this crispr