ID: 1057509834

View in Genome Browser
Species Human (GRCh38)
Location 9:95669214-95669236
Sequence CCCAGAAACAGAAGGCACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057509834_1057509849 17 Left 1057509834 9:95669214-95669236 CCCCTGTGCCTTCTGTTTCTGGG No data
Right 1057509849 9:95669254-95669276 CTCCCTGGAAGGAGACCCTGAGG No data
1057509834_1057509841 -6 Left 1057509834 9:95669214-95669236 CCCCTGTGCCTTCTGTTTCTGGG No data
Right 1057509841 9:95669231-95669253 TCTGGGACCCCGGATAACCCGGG No data
1057509834_1057509840 -7 Left 1057509834 9:95669214-95669236 CCCCTGTGCCTTCTGTTTCTGGG No data
Right 1057509840 9:95669230-95669252 TTCTGGGACCCCGGATAACCCGG No data
1057509834_1057509844 2 Left 1057509834 9:95669214-95669236 CCCCTGTGCCTTCTGTTTCTGGG No data
Right 1057509844 9:95669239-95669261 CCCGGATAACCCGGGCTCCCTGG No data
1057509834_1057509846 6 Left 1057509834 9:95669214-95669236 CCCCTGTGCCTTCTGTTTCTGGG No data
Right 1057509846 9:95669243-95669265 GATAACCCGGGCTCCCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057509834 Original CRISPR CCCAGAAACAGAAGGCACAG GGG (reversed) Intergenic
No off target data available for this crispr