ID: 1057509839

View in Genome Browser
Species Human (GRCh38)
Location 9:95669222-95669244
Sequence TCCGGGGTCCCAGAAACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057509839_1057509844 -6 Left 1057509839 9:95669222-95669244 CCTTCTGTTTCTGGGACCCCGGA No data
Right 1057509844 9:95669239-95669261 CCCGGATAACCCGGGCTCCCTGG No data
1057509839_1057509849 9 Left 1057509839 9:95669222-95669244 CCTTCTGTTTCTGGGACCCCGGA No data
Right 1057509849 9:95669254-95669276 CTCCCTGGAAGGAGACCCTGAGG No data
1057509839_1057509853 24 Left 1057509839 9:95669222-95669244 CCTTCTGTTTCTGGGACCCCGGA No data
Right 1057509853 9:95669269-95669291 CCCTGAGGAGATTTGCCAGCAGG No data
1057509839_1057509846 -2 Left 1057509839 9:95669222-95669244 CCTTCTGTTTCTGGGACCCCGGA No data
Right 1057509846 9:95669243-95669265 GATAACCCGGGCTCCCTGGAAGG No data
1057509839_1057509855 27 Left 1057509839 9:95669222-95669244 CCTTCTGTTTCTGGGACCCCGGA No data
Right 1057509855 9:95669272-95669294 TGAGGAGATTTGCCAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057509839 Original CRISPR TCCGGGGTCCCAGAAACAGA AGG (reversed) Intergenic
No off target data available for this crispr