ID: 1057509842

View in Genome Browser
Species Human (GRCh38)
Location 9:95669238-95669260
Sequence CAGGGAGCCCGGGTTATCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057509842_1057509856 19 Left 1057509842 9:95669238-95669260 CCCCGGATAACCCGGGCTCCCTG No data
Right 1057509856 9:95669280-95669302 TTTGCCAGCAGGAGGTTTATCGG No data
1057509842_1057509857 20 Left 1057509842 9:95669238-95669260 CCCCGGATAACCCGGGCTCCCTG No data
Right 1057509857 9:95669281-95669303 TTGCCAGCAGGAGGTTTATCGGG No data
1057509842_1057509855 11 Left 1057509842 9:95669238-95669260 CCCCGGATAACCCGGGCTCCCTG No data
Right 1057509855 9:95669272-95669294 TGAGGAGATTTGCCAGCAGGAGG No data
1057509842_1057509849 -7 Left 1057509842 9:95669238-95669260 CCCCGGATAACCCGGGCTCCCTG No data
Right 1057509849 9:95669254-95669276 CTCCCTGGAAGGAGACCCTGAGG No data
1057509842_1057509853 8 Left 1057509842 9:95669238-95669260 CCCCGGATAACCCGGGCTCCCTG No data
Right 1057509853 9:95669269-95669291 CCCTGAGGAGATTTGCCAGCAGG No data
1057509842_1057509858 21 Left 1057509842 9:95669238-95669260 CCCCGGATAACCCGGGCTCCCTG No data
Right 1057509858 9:95669282-95669304 TGCCAGCAGGAGGTTTATCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057509842 Original CRISPR CAGGGAGCCCGGGTTATCCG GGG (reversed) Intergenic
No off target data available for this crispr