ID: 1057509846

View in Genome Browser
Species Human (GRCh38)
Location 9:95669243-95669265
Sequence GATAACCCGGGCTCCCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057509834_1057509846 6 Left 1057509834 9:95669214-95669236 CCCCTGTGCCTTCTGTTTCTGGG No data
Right 1057509846 9:95669243-95669265 GATAACCCGGGCTCCCTGGAAGG No data
1057509837_1057509846 4 Left 1057509837 9:95669216-95669238 CCTGTGCCTTCTGTTTCTGGGAC No data
Right 1057509846 9:95669243-95669265 GATAACCCGGGCTCCCTGGAAGG No data
1057509839_1057509846 -2 Left 1057509839 9:95669222-95669244 CCTTCTGTTTCTGGGACCCCGGA No data
Right 1057509846 9:95669243-95669265 GATAACCCGGGCTCCCTGGAAGG No data
1057509836_1057509846 5 Left 1057509836 9:95669215-95669237 CCCTGTGCCTTCTGTTTCTGGGA No data
Right 1057509846 9:95669243-95669265 GATAACCCGGGCTCCCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057509846 Original CRISPR GATAACCCGGGCTCCCTGGA AGG Intergenic
No off target data available for this crispr