ID: 1057509849

View in Genome Browser
Species Human (GRCh38)
Location 9:95669254-95669276
Sequence CTCCCTGGAAGGAGACCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057509842_1057509849 -7 Left 1057509842 9:95669238-95669260 CCCCGGATAACCCGGGCTCCCTG No data
Right 1057509849 9:95669254-95669276 CTCCCTGGAAGGAGACCCTGAGG No data
1057509837_1057509849 15 Left 1057509837 9:95669216-95669238 CCTGTGCCTTCTGTTTCTGGGAC No data
Right 1057509849 9:95669254-95669276 CTCCCTGGAAGGAGACCCTGAGG No data
1057509839_1057509849 9 Left 1057509839 9:95669222-95669244 CCTTCTGTTTCTGGGACCCCGGA No data
Right 1057509849 9:95669254-95669276 CTCCCTGGAAGGAGACCCTGAGG No data
1057509836_1057509849 16 Left 1057509836 9:95669215-95669237 CCCTGTGCCTTCTGTTTCTGGGA No data
Right 1057509849 9:95669254-95669276 CTCCCTGGAAGGAGACCCTGAGG No data
1057509834_1057509849 17 Left 1057509834 9:95669214-95669236 CCCCTGTGCCTTCTGTTTCTGGG No data
Right 1057509849 9:95669254-95669276 CTCCCTGGAAGGAGACCCTGAGG No data
1057509843_1057509849 -8 Left 1057509843 9:95669239-95669261 CCCGGATAACCCGGGCTCCCTGG No data
Right 1057509849 9:95669254-95669276 CTCCCTGGAAGGAGACCCTGAGG No data
1057509845_1057509849 -9 Left 1057509845 9:95669240-95669262 CCGGATAACCCGGGCTCCCTGGA No data
Right 1057509849 9:95669254-95669276 CTCCCTGGAAGGAGACCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057509849 Original CRISPR CTCCCTGGAAGGAGACCCTG AGG Intergenic
No off target data available for this crispr