ID: 1057509855

View in Genome Browser
Species Human (GRCh38)
Location 9:95669272-95669294
Sequence TGAGGAGATTTGCCAGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057509847_1057509855 1 Left 1057509847 9:95669248-95669270 CCCGGGCTCCCTGGAAGGAGACC No data
Right 1057509855 9:95669272-95669294 TGAGGAGATTTGCCAGCAGGAGG No data
1057509845_1057509855 9 Left 1057509845 9:95669240-95669262 CCGGATAACCCGGGCTCCCTGGA No data
Right 1057509855 9:95669272-95669294 TGAGGAGATTTGCCAGCAGGAGG No data
1057509839_1057509855 27 Left 1057509839 9:95669222-95669244 CCTTCTGTTTCTGGGACCCCGGA No data
Right 1057509855 9:95669272-95669294 TGAGGAGATTTGCCAGCAGGAGG No data
1057509843_1057509855 10 Left 1057509843 9:95669239-95669261 CCCGGATAACCCGGGCTCCCTGG No data
Right 1057509855 9:95669272-95669294 TGAGGAGATTTGCCAGCAGGAGG No data
1057509848_1057509855 0 Left 1057509848 9:95669249-95669271 CCGGGCTCCCTGGAAGGAGACCC No data
Right 1057509855 9:95669272-95669294 TGAGGAGATTTGCCAGCAGGAGG No data
1057509842_1057509855 11 Left 1057509842 9:95669238-95669260 CCCCGGATAACCCGGGCTCCCTG No data
Right 1057509855 9:95669272-95669294 TGAGGAGATTTGCCAGCAGGAGG No data
1057509851_1057509855 -8 Left 1057509851 9:95669257-95669279 CCTGGAAGGAGACCCTGAGGAGA No data
Right 1057509855 9:95669272-95669294 TGAGGAGATTTGCCAGCAGGAGG No data
1057509850_1057509855 -7 Left 1057509850 9:95669256-95669278 CCCTGGAAGGAGACCCTGAGGAG No data
Right 1057509855 9:95669272-95669294 TGAGGAGATTTGCCAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057509855 Original CRISPR TGAGGAGATTTGCCAGCAGG AGG Intergenic
No off target data available for this crispr