ID: 1057510779

View in Genome Browser
Species Human (GRCh38)
Location 9:95678196-95678218
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057510779_1057510787 27 Left 1057510779 9:95678196-95678218 CCTGCAGAACACCTTAGAGATAC No data
Right 1057510787 9:95678246-95678268 GCAGTGTTCAGCTCTCAGAAAGG No data
1057510779_1057510784 5 Left 1057510779 9:95678196-95678218 CCTGCAGAACACCTTAGAGATAC No data
Right 1057510784 9:95678224-95678246 TTGGGTAGCTCCTCTCCAGTGGG No data
1057510779_1057510783 4 Left 1057510779 9:95678196-95678218 CCTGCAGAACACCTTAGAGATAC No data
Right 1057510783 9:95678223-95678245 ATTGGGTAGCTCCTCTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057510779 Original CRISPR GTATCTCTAAGGTGTTCTGC AGG (reversed) Intergenic
No off target data available for this crispr