ID: 1057510787

View in Genome Browser
Species Human (GRCh38)
Location 9:95678246-95678268
Sequence GCAGTGTTCAGCTCTCAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057510779_1057510787 27 Left 1057510779 9:95678196-95678218 CCTGCAGAACACCTTAGAGATAC No data
Right 1057510787 9:95678246-95678268 GCAGTGTTCAGCTCTCAGAAAGG No data
1057510782_1057510787 16 Left 1057510782 9:95678207-95678229 CCTTAGAGATACGCACATTGGGT No data
Right 1057510787 9:95678246-95678268 GCAGTGTTCAGCTCTCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057510787 Original CRISPR GCAGTGTTCAGCTCTCAGAA AGG Intergenic
No off target data available for this crispr