ID: 1057511651

View in Genome Browser
Species Human (GRCh38)
Location 9:95684847-95684869
Sequence CTGCTGGCAAATCTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057511651_1057511658 10 Left 1057511651 9:95684847-95684869 CCCAGCCCCAGATTTGCCAGCAG No data
Right 1057511658 9:95684880-95684902 TGCAGTGCTTGACACATGGCAGG No data
1057511651_1057511657 6 Left 1057511651 9:95684847-95684869 CCCAGCCCCAGATTTGCCAGCAG No data
Right 1057511657 9:95684876-95684898 CTTGTGCAGTGCTTGACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057511651 Original CRISPR CTGCTGGCAAATCTGGGGCT GGG (reversed) Intergenic
No off target data available for this crispr