ID: 1057513187

View in Genome Browser
Species Human (GRCh38)
Location 9:95697939-95697961
Sequence CAGCGCGATTCCGTGGGCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2942
Summary {0: 16, 1: 450, 2: 786, 3: 859, 4: 831}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057513187_1057513195 30 Left 1057513187 9:95697939-95697961 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1057513195 9:95697992-95698014 GCAAGGCGGCAACGAGGCTGGGG 0: 316
1: 1145
2: 1873
3: 1683
4: 815
1057513187_1057513190 13 Left 1057513187 9:95697939-95697961 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1057513190 9:95697975-95697997 CAGTCTGAGATCAAACTGCAAGG 0: 3663
1: 1439
2: 732
3: 491
4: 588
1057513187_1057513193 28 Left 1057513187 9:95697939-95697961 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1057513193 9:95697990-95698012 CTGCAAGGCGGCAACGAGGCTGG 0: 315
1: 1152
2: 1845
3: 1595
4: 741
1057513187_1057513194 29 Left 1057513187 9:95697939-95697961 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1057513194 9:95697991-95698013 TGCAAGGCGGCAACGAGGCTGGG 0: 317
1: 1173
2: 1908
3: 1654
4: 702
1057513187_1057513192 24 Left 1057513187 9:95697939-95697961 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1057513192 9:95697986-95698008 CAAACTGCAAGGCGGCAACGAGG 0: 317
1: 1166
2: 1768
3: 1553
4: 836
1057513187_1057513191 16 Left 1057513187 9:95697939-95697961 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1057513191 9:95697978-95698000 TCTGAGATCAAACTGCAAGGCGG 0: 2869
1: 1007
2: 456
3: 293
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057513187 Original CRISPR CAGCGCGATTCCGTGGGCGT AGG (reversed) Intergenic
Too many off-targets to display for this crispr