ID: 1057514262

View in Genome Browser
Species Human (GRCh38)
Location 9:95708180-95708202
Sequence TCAGCTTTAGGAGGCCAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057514262_1057514267 4 Left 1057514262 9:95708180-95708202 CCCCGCTGGCCTCCTAAAGCTGA No data
Right 1057514267 9:95708207-95708229 TACTCTTCCAAATCTGTCTAAGG No data
1057514262_1057514270 21 Left 1057514262 9:95708180-95708202 CCCCGCTGGCCTCCTAAAGCTGA No data
Right 1057514270 9:95708224-95708246 CTAAGGTTGACCCTCCATGTGGG No data
1057514262_1057514269 20 Left 1057514262 9:95708180-95708202 CCCCGCTGGCCTCCTAAAGCTGA No data
Right 1057514269 9:95708223-95708245 TCTAAGGTTGACCCTCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057514262 Original CRISPR TCAGCTTTAGGAGGCCAGCG GGG (reversed) Intergenic