ID: 1057514262 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:95708180-95708202 |
| Sequence | TCAGCTTTAGGAGGCCAGCG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1057514262_1057514267 | 4 | Left | 1057514262 | 9:95708180-95708202 | CCCCGCTGGCCTCCTAAAGCTGA | No data | ||
| Right | 1057514267 | 9:95708207-95708229 | TACTCTTCCAAATCTGTCTAAGG | No data | ||||
| 1057514262_1057514270 | 21 | Left | 1057514262 | 9:95708180-95708202 | CCCCGCTGGCCTCCTAAAGCTGA | No data | ||
| Right | 1057514270 | 9:95708224-95708246 | CTAAGGTTGACCCTCCATGTGGG | No data | ||||
| 1057514262_1057514269 | 20 | Left | 1057514262 | 9:95708180-95708202 | CCCCGCTGGCCTCCTAAAGCTGA | No data | ||
| Right | 1057514269 | 9:95708223-95708245 | TCTAAGGTTGACCCTCCATGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1057514262 | Original CRISPR | TCAGCTTTAGGAGGCCAGCG GGG (reversed) | Intergenic | ||