ID: 1057514266

View in Genome Browser
Species Human (GRCh38)
Location 9:95708192-95708214
Sequence GAAGAGTAATTCTCAGCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057514266_1057514274 30 Left 1057514266 9:95708192-95708214 CCTAAAGCTGAGAATTACTCTTC No data
Right 1057514274 9:95708245-95708267 GGTGAACGTGTCCCAGTGAGTGG No data
1057514266_1057514269 8 Left 1057514266 9:95708192-95708214 CCTAAAGCTGAGAATTACTCTTC No data
Right 1057514269 9:95708223-95708245 TCTAAGGTTGACCCTCCATGTGG No data
1057514266_1057514270 9 Left 1057514266 9:95708192-95708214 CCTAAAGCTGAGAATTACTCTTC No data
Right 1057514270 9:95708224-95708246 CTAAGGTTGACCCTCCATGTGGG No data
1057514266_1057514267 -8 Left 1057514266 9:95708192-95708214 CCTAAAGCTGAGAATTACTCTTC No data
Right 1057514267 9:95708207-95708229 TACTCTTCCAAATCTGTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057514266 Original CRISPR GAAGAGTAATTCTCAGCTTT AGG (reversed) Intergenic